We narrowed to 11,666 results for: 110
-
Plasmid#8708DepositorInsertStat3 S727A (Stat3 Mouse)
ExpressionMammalianMutationS727A (exhibits o serine phosphorylation either c…Available SinceAug. 11, 2005AvailabilityAcademic Institutions and Nonprofits only -
GFP-ZMYND11
Plasmid#65402PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL4.26-Ccnd2PromoterRegion2(0.5kb)
Plasmid#228059Purpose0.5 kb from mouse Ccnd2 promoter in front of firefly luciferase reporterDepositorInsertCcnd2 promoter (Ccnd2 Mouse)
UseLuciferaseAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.26-Igf2Promoter
Plasmid#228060Purpose0.9 kb from mouse Igf2 promoter in front of firefly luciferase reporterDepositorInsertIgf2 promoter (Igf2 Mouse)
UseLuciferaseAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNAZeo(-) LAMP2C
Plasmid#89342PurposeExpresses human LAMP-2C in mammalian cellsDepositorAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMGS56 (GFP-ARF16-PB1-P2A-OsTIR1)
Plasmid#129668PurposeA repair construct to express GFP-ARF16-PB1 and OsTIR1 under the control of the CMV promoter from the human AAVS1 locusDepositorInsertOsARF16-PB1 domain
TagsGFPExpressionMammalianAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pETM33_CLIP_CAP_Gly
Plasmid#178470PurposeBacterial expression of human domain with His-tag and GST tagDepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/MPL-V5
Plasmid#204531PurposeMammalian expression of human MPL-V5DepositorInsertMPL-V5 (MPL Human)
ExpressionMammalianAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMJA285= pSin-TCRab-CMVp-Puro
Plasmid#116875Purposestable TCR expression in human T cellsDepositorUseLentiviralExpressionMammalianMutationdeletion of EF1-a promotorPromoterCMV PromotorAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
GAL-p300-1000-1600
Plasmid#89101Purposemammalian expression of human p300 amino acids 1000-1600 with N-terminal GAL4 DNA binding domainDepositorAvailable SinceApril 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM33_EIF4E_eiF4E
Plasmid#178474PurposeBacterial expression of human domain with His-tag and GST tagDepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
GAL-p300-2-300
Plasmid#89098Purposemammalian expression of human p300 amino acids 2-300 with N-terminal GAL4 DNA binding domainDepositorAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM41_KPNA4_Arm
Plasmid#178478PurposeBacterial expression of human domain with His-tag and MBP tagDepositorAvailable SinceMarch 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
GAL-p300-1901-2414
Plasmid#89103Purposemammalian expression of human p300 amino acids 1901-2414 with N-terminal GAL4 DNA binding domainDepositorAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM33_MDM2_SWIB
Plasmid#178481PurposeBacterial expression of human domain with His-tag and GST tagDepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA14
Plasmid#199586PurposeContains guide RNA to 5' end of mouse EZH2 geneDepositorAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
ITPKA-mTurquoise2
Plasmid#137811PurposeIn vivo visualization of actin cytoskeleton (can be used for colocalization studies)DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2200
Plasmid#91082PurposeModule C, Promoter: none – to be combined with gRNA array in module B, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers (only works with pMOD_B2203), Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers
UseCRISPRPromoternone (will be fused to gRNA array in MODULE B)Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM33_USP7_MATH
Plasmid#178490PurposeBacterial expression of human domain with His-tag and GST tagDepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only