We narrowed to 16,217 results for: GRN
-
Plasmid#79888PurposeExpresses the AAVS1 T2 gRNA in combination with FLAGless eSpCas9(1.1) to target the AAVS1 "safe harbor" locus.DepositorTypeEmpty backboneUseCRISPRTagsUntagged eSpCas9(1.1)ExpressionMammalianPromoterCBhAvailable SinceJuly 29, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pSpCas9(BB)-2A-GFP (PX458)
Plasmid#48138PurposeCas9 from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorHas ServiceCloning Grade DNAInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT21
Plasmid#223393PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by 2x35s and the sgRNA was driven by AtU3 promoter.DepositorInsert2x35s-hA3A-Y130F-SpRYD10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-GFP (PX461)
Plasmid#48140PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorInserthSpCas9n
UseCRISPRTags3XFLAG and GFPExpressionMammalianMutationCas9 D10A nickase mutantPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Cas9_Blast
Plasmid#125592PurposeLentiviral expression of spCas9 with blasticidin resistance geneDepositorInsertCas9
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEFS promoterAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
iMAP-61
Plasmid#187460PurposegRNA array of iMAP-61DepositorInsertsgRNA array
UsePiggybacExpressionMammalianPromotermodified U6Available SinceOct. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDAS12489_PEAR-GFP_2in1_2.0
Plasmid#177186PurposePEAR-GFP3 plasmid with a pegRNA that targets its own plasmidDepositorInsertsEGFP split with an intron between amino acids 95-96
pegRNA targeting its own plasmid
UseCRISPRExpressionMammalianMutationdisrupted 5' splice sitePromoterCMV and U6Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgLKB1 clone1
Plasmid#162125PurposeLentiviral sgRNA plasmid targeting human LKB1DepositorInsertsgLKB1 (STK11 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgLKB1 clone2
Plasmid#162126PurposeLentiviral sgRNA plasmid targeting human LKB1DepositorInsertsgLKB1 (STK11 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
piggyFlex
Plasmid#218234PurposeA piggyBac transposon-based gRNA expression vector, to allow for genomic integration and stable expression of gRNAs. Contains both antibiotic (puromycin) and fluorophore (GFP) markers.DepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRia-v2
Plasmid#84832PurposeCRISPRi/a V2 library parental plasmidDepositorInsertssgRNA
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRDA_550
Plasmid#203398PurposeAll-in-one lentiviral expression of gRNA and EnAsCas12aDepositorInsertEnhanced Acidaminococcus Cas12a
UseCRISPR and LentiviralPromoterEF1aAvailable SinceAug. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0
Plasmid#62987PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-Puro, and cloning backbone for sgRNA (V2.0)DepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationCas9 D10A nickase mutantAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNICKclos1.0
Plasmid#73639PurposeGenome editing for gene pyrE (CAC-002) in Clostridium acetobutylicum ATCC 824DepositorInsertsCas9 nickase
sGRNA to pyrE
UseE.coli-clostridium shuttle vectorMutationD10APromoterj23119 and ptbAvailable SinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMT449
Plasmid#139389PurposeBile Acid inducible sgRNA-2 with PM2 driving Nanoluc expression (NOT Gate 2), pNBU1 backbone, AmpR, ErmRDepositorInsertBile Acid inducible sgRNA-2 with PM2 driving Nanoluc expression (NOT Gate 2)
UseSynthetic BiologyPromoterBile Acid inducible PromoterAvailable SinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZR043_Lenti-U6-sgEGFR-MS2-PP7-hPGK-PCP-p65-HSF1-Puro
Plasmid#180267PurposeLentiviral expression vector for CRISPRa-SAM with EGFR targeting sgRNADepositorInsertEGFR sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT19
Plasmid#223391PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter.DepositorInsertAtUBQ10-hA3A-Y130F-SpRYD10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFC334
Plasmid#87846PurposeAMA1 plasmid with Aspergillus optimized Cas9, argB selection marker and yA specific sgRNA expressed with ribozymesDepositorInsertsCas9
argB
yA specific sgRNA
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterA. nidulans gpdA promoter with Hammerhead ribozym…Available SinceMay 9, 2017AvailabilityAcademic Institutions and Nonprofits only