We narrowed to 7,223 results for: ALP
-
Plasmid#183653PurposePtdIns(3,4,5)P3 biosensorDepositorInsertBTK (BTK Frog, Human)
UseTagsX. laevis map2k1.L(32-44)-mCherryExpressionMammalianMutationAmino acids 2-170PromoterCMVAvailable sinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF2α P405A/N847A Δ450-572-pBabe-Puro
Plasmid#25936DepositorInsertHypoxia inducible factor 2 alpha (EPAS1 Human)
UseRetroviralTagsHA-tagExpressionMammalianMutationcDNA changed amino acids: Proline 405 to Alanin…PromoterAvailable sinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gai1
Plasmid#196048PurposeEncodes a G alpha subunit (GNAl1) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple (bidirectional) GasS
Plasmid#196055PurposeEncodes a G alpha subunit (GNAS2) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorInsertsUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-CAMK2A
Plasmid#23408DepositorInsertCAMK2A (CAMK2A Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
Capping Protein
Plasmid#89950PurposeF-actin-capping proteins bind in a Ca2+-independent manner to the fast growing ends of actin filaments (barbed end) thereby blocking the exchange of subunits at these ends.DepositorInsertsUseTags6*HisExpressionBacterialMutationV222IPromoterAvailable sinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_HIF1A_WT
Plasmid#82129PurposeGateway Donor vector containing HIF1A , part of the Target Accelerator Plasmid Collection.DepositorInsertHIF1A (HIF1A Human)
UseGateway entry vectorTagsExpressionMutationWTPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PIK3CA
Plasmid#23466DepositorInsertPIK3CA (PIK3CA Human)
UseGateway donor vectorTagsExpressionMutationA1035VPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_ERO1L_WT
Plasmid#81797PurposeGateway Donor vector containing ERO1L , part of the Target Accelerator Plasmid Collection.DepositorInsertERO1L (ERO1A Human)
UseGateway entry vectorTagsExpressionMutationWTPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
KRD9_HBA1(HBA1reg-HBB)
Plasmid#232402PurposeAAV production plasmid for HBA1 UTRs vector from Fig. 3 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBB gene includes introns; HBA1 UTRs flank HBA1 cassette. HAs are ~400bp each.DepositorInsertHemoglobin Subunit Alpha 1 (HBA1 Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
KRD2_HBA1(HBA1reg-UbC-GFP)
Plasmid#232401PurposeAAV production plasmid for HBA1 WGR vector from Fig. 1 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBA1 UTRs flank UbC-GFP cassette; GFP is followed by BGH polyA. HAs are ~400bp each.DepositorInsertHemoglobin Subunit Alpha 1 (HBA1 Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLViN-iRFP670-α-cateninA+ΔβH
Plasmid#229707PurposeLentiviral expression of iRFP670-alpha-cateninA+delta-beta-H in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseLentiviralTagsiRFP670ExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnma1
Plasmid#209199PurposeMutagenesis of Kcnma1DepositorInsertKcnma1 (Kcnma1 Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterCMVAvailable sinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-Slo1 K+ channel [L6/60R-1]
Plasmid#206694PurposeMammalian Expression Plasmid of anti-Slo1 K+ channel (Mouse). Derived from hybridoma L6/60-1.DepositorInsertanti-Slo1 K+ channel (Mus musculus) recombinant Mouse monoclonal antibody (Kcnma1 Mouse)
UseTagsExpressionMammalianMutationPromoterDual CMVAvailable sinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gai3
Plasmid#196050PurposeEncodes a G alpha subunit (GNAl3) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Ga12
Plasmid#196061PurposeEncodes a G alpha subunit (GNA12) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Ga13
Plasmid#196062PurposeEncodes a G alpha subunit (GNA13) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
KRD22_HBA1(HBA1reg-HBB-longHAs)
Plasmid#232403PurposeAAV production plasmid for HBA1 long HAs vector from Figs. 3-6 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBB gene includes introns; HBA1 UTRs flank full HBA1-2A-YFP cassette. HAs are ~900bpDepositorUseTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
HisGB1-Fusion + CBP TAZ1(340-439)
Plasmid#173762PurposeBacterial coexpression of CBP TAZ1 and CITED2/Hif1a activation domain constructsDepositorUseTagsHis6GB1 and thrombinExpressionBacterialMutationfusion of CITED2 and Hif1aPromoterT7Available sinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
HisGB1-FusionL21A + CBP TAZ1(340-439)
Plasmid#173763PurposeBacterial Coexpression of CBP TAZ1 with CITED2/Hif1a activation domain constructsDepositorUseTagsHis6GB1 and thrombinExpressionBacterialMutationfusion of CITED2 and Hif1aPromoterT7Available sinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
HIsGB1-FusionL63A + CBP TAZ1(340-439)
Plasmid#173764PurposeBacterial coexpression of CBP TAZ1 with CITED2/Hif1a activation domain constructsDepositorUseTagsHis6GB1 and thrombinExpressionBacterialMutationfusion of CITED2 and Hif1aPromoterT7Available sinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gai2
Plasmid#196049PurposeEncodes a G alpha subunit (GNAl2) with RLuc8, a G gamma subunit (GNG8) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Ga11
Plasmid#196059PurposeEncodes a G alpha subunit (GNA11) with RLuc8, a G gamma subunit (GNG13) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceFeb. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gagust
Plasmid#196054PurposeEncodes a G alpha subunit (GNAT3) with RLuc8, a G gamma subunit (GNG1) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Ga15
Plasmid#196060PurposeEncodes a G alpha subunit (GNA15) with RLuc8, a G gamma subunit (GNG13) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB513B-1/TRE-hHNF1α-hHNF3β-hCEBPα-hCEBPβ-hCEBPγ-EF1α-Puro
Plasmid#199550PurposePiggyBac-based transposon vector plasmid which encodes the expression units of liver-enriched transcription factor genes (hHNF1α-hHNF3β-hCEBPα-hCEBPβ-hCEBP-γ) under control of the TRE/PCMVmin promoterDepositorUsePiggybac transposon vectorTagsExpressionMammalianMutationPromoterTRE+CMVmin promoterAvailable sinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2975
Plasmid#144451PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertNAT10 (NAT10 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2510
Plasmid#144032PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertNAT10 (NAT10 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEMS1499
Plasmid#29247PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle28 (CCL27 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSExpressionMutationPromoterAvailable sinceNov. 7, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1498
Plasmid#29246PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle27 (CCL27 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSExpressionMutationPromoterAvailable sinceNov. 7, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1500
Plasmid#29248PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle29 (CCL27 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSExpressionMutationPromoterAvailable sinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHIV-Luc-ZsGreen
Plasmid#39196DepositorInsertsFirefly Luciferase Luc2P
ZsGreen
UseLentiviralTagsExpressionMammalianMutationPromoterEF1-alpha and EF1-alphaAvailable sinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHIV-Luciferase
Plasmid#21375Purposeself-inactivating 3rd generation lentiviral plasmid for co-expression of your gene of interest and LuciferaseDepositorTypeEmpty backboneUseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 19, 2009AvailabilityAcademic Institutions and Nonprofits only -
Gaq-LSS-SGFP2
Plasmid#112951PurposeGalphaq tagged with LSS-SGFP2DepositorInsertGalphaq
UseTagsLSS-SGFP2ExpressionMammalianMutationPromoterCMVAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-C1-p85beta
Plasmid#1408DepositorInsertPI3K regulatory subunit p85beta (Pik3r2 Mouse)
UseTagseYFPExpressionMammalianMutationPromoterAvailable sinceJune 22, 2006AvailabilityAcademic Institutions and Nonprofits only -
pRSV-PKI-v2
Plasmid#45066PurposeExpression of PKI (PKA inhibitor)DepositorInsertcAMP-dependent protein kinase inhibitor alpha
UseTagsExpressionMammalianMutationPromoterRSVAvailable sinceJuly 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T3-p85beta
Plasmid#1406DepositorInsertPI3K regulatory subunit p85beta (Pik3r2 Mouse)
UseTagsGSTExpressionBacterialMutationPromoterAvailable sinceNov. 14, 2005AvailabilityAcademic Institutions and Nonprofits only -
pRSV-PKImut-v2
Plasmid#45067PurposeExpression of intactive PKI (PKA inhibitor) mutantDepositorInsertcAMP-dependent protein kinase inhibitor alpha
UseTagsExpressionMammalianMutationchanged Arg 20 & 21 to GlycinesPromoterRSVAvailable sinceJuly 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHCA/GAL4(848).ER
Plasmid#108215PurposeYeast expression vector for fusion of Gal4 AA 1-848 to hormone binding domain of estrogen receptor aDepositorInsertGal4-ERalpha HBD
UseTagsExpressionYeastMutationERalpha HBD has G400V mutationPromoterADH0Available sinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1A
Plasmid#185382PurposeFor mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1ADepositorInsertPPM1A (PPM1A Human)
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only