We narrowed to 13,991 results for: CAR
-
Plasmid#193016PurposeExcitatory neuron-specific reporter (hSyn promoter, Synrg exon, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-832_NY-ESO-1_TCR_FAS/4-1BB
Plasmid#207495PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertFAS/4-1BB, NY-ESO-1_TCR (FAS Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α1.1-FLPX-rc [ChrimsonR-tdTomato]
Plasmid#128587PurposeAAV-mediated expression of ChrimsonR-tdTomato under the EF1α1.1 promoter in frt/reversed (Flp-dependent) manner. tdTomato has codons varied to reduce recombination.DepositorInsertChrimsonR-tdTomato
UseAAVTagstdTomato (codon diversified version)ExpressionMammalianMutationChrimson K176R mutantPromoterEF1α (1.1 kb short version)Available SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLJM5-C234S PHGDH
Plasmid#83902Purposestable overexpressionDepositorInsertPhosphoglycerate dehydrogenase (PHGDH Human)
UseLentiviralExpressionMammalianMutationquikchanged cysteine 234 to serinePromoterCMVAvailable SinceOct. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W1K)-PGKpuro2AmCherry-W
Plasmid#163176PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-4
Plasmid#223225Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-3
Plasmid#223224Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-1
Plasmid#223223Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-835_NY-ESO-1_TCR_FAS/MyD88
Plasmid#207498PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertFAS/MyD88, NY-ESO-1_TCR (FAS Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET30-2-PHGDH-C234S
Plasmid#107724PurposeExpression of PHGDH C234S in bacteriaDepositorAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIG-834_NY-ESO-1_TCR_FAS/IL4R
Plasmid#207497PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertFAS/IL4R, NY-ESO-1_TCR (FAS Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT2-shATRX
Plasmid#124258PurposeExpresses shRNA targeting ATRX. Construct has inverted repeats to be used in Sleeping beauty system.DepositorInsertshATRX
ExpressionMammalianAvailable SinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX304_zeo_mmFbxw7_R505C
Plasmid#160104PurposeExpresses murine Fbxw7 alpha with the R505C loss-of-function mutation in mammalian cellsDepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Jaws-KGC-tdTomato-ER2
Plasmid#153538PurposeAAV-mediated expression of Jaws-tdTomato-ER2 under the EF1α promoter (1.1kb short version).DepositorInsertJaws-KGC-tdTomato-ER2
UseAAVTagsER2, KGC, and tdTomatoExpressionMammalianMutationK200R W214FPromoterEF1α1.1Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-fd [Chronos-GFP]
Plasmid#84482PurposeAAV-mediated expression of Chronos-GFP under the Syn promoter, in floxed/forward (Cre-dependent) manner. Cre turns gene off. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
GST-FUS 465-526
Plasmid#44983DepositorInsertFUS (465-526aa) (FUS Human)
TagsGSTExpressionBacterialMutationcontains amino acids 465-526PromotertacAvailable SinceJune 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Cas9-T2A-STOP-TdT
Plasmid#126425PurposeExpresses Cas9 but not TdT in mammalian cells; control for pcDNA-Cas9-T2A-TdT. (pTBL552)DepositorInsertCas9-T2A-STOP-TdT (DNTT Human, Streptococcus pyogenes)
ExpressionMammalianMutationalanine-6 of TdT has been changed to a STOP codonPromoterpCMVAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSN879
Plasmid#190693PurposeKnockdown mouse KIF5A, KIF5B and KIF5C simultaneously. mScarlet::miRNA(KIF5C)::miRNA(KIF5B)::miRNA(KIF5A).DepositorUseRNAiExpressionMammalianPromoterCMVAvailable SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_7
Plasmid#60293PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only