We narrowed to 69,679 results for: TOR
-
Plasmid#209918PurposeA FRET biosensor for ROCK activityDepositorInsertEevee-ROCK-NES
UseLentiviralTagsECFP and YPetAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-D2s-L-Venus
Plasmid#19966DepositorInsertD2 short variant-monomeric Venus (DRD2 Aequorea Victoria, Human)
TagsFlag and monomeric VenusExpressionMammalianAvailable SinceJan. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pVeBtA2
Plasmid#238987PurposeMammalian expression of bovine arrestin-2 long isoform with Venus N-terminal fusionDepositorAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330_TOMM20 sgRNA / hSpCas9
Plasmid#172836PurposeMammalian expression of a sgRNA targeting the intron 4 (last intron) of TOMM20 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 4 of TOMM20 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
STAgR_Neo
Plasmid#102992PurposeCan be used as backbone for a STAgR reactionDepositorTypeEmpty backboneUseCRISPR; Pcr template for stagr vectorsPromoterU6Available SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
PF4-bio-His
Plasmid#53411PurposeExpresses full-length Platelet factor 4 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertPF4 (PF4 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP.N1-HDAC6.delta Buz
Plasmid#36190DepositorInsertHDAC6..delta Buz (HDAC6 Human)
TagsEGFPExpressionMammalianMutationDeletion of the C-terminal ub binding domain (BUZ…PromoterCMVAvailable SinceApril 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGEX-KG-Itch/2793
Plasmid#11434DepositorAvailable SinceApril 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGEX-gp78c/2767
Plasmid#11429DepositorAvailable SinceJuly 19, 2006AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
HsGRK6-mVenus
Plasmid#137780PurposeVisualization of GRK6DepositorAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
[pSK468] pLJC5 Flag-Depdc5
Plasmid#109337PurposeLenti-viral expression of Flag-tagged wildtype Depdc5DepositorAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBS L30 Ruby3-Rab6A
Plasmid#135653PurposeRab6A fused to the red fluorescent protein Ruby3 in N-ter under control of a weak L30 promoter.DepositorInsertRab6A
TagsRuby3ExpressionMammalianPromoterL30Available SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
1119 pBabe puroL HA FKHR AAA
Plasmid#9025DepositorAvailable SinceApril 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 HA pCAGGS
Plasmid#206054Purposeexpression of rabbit Cav2.2 calcium channel with a N-terminal GFP tag and an exofacial double HA tag in domain IIDepositorAvailable SinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
PLK3 1-334-pEGFP
Plasmid#23266DepositorAvailable SinceDec. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pPPEDs
Plasmid#162469Purposeprotoplast test vector of pPPEDDepositorInsertsCas9H840A
attR gateway destination cassette
UsePrime editing destination vector for transient ex…TagsMLV reverse transcriptaseExpressionPlantMutationChange histidine 840 to AlanineAvailable SinceDec. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_CALR sgRNA / hSpCas9
Plasmid#172838PurposeMammalian expression of a sgRNA targeting the intron 1 of CALR (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of CALR under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
MoFGFR1c-ires neo
Plasmid#86490Purposemamalian cell expression of FGFR1cDepositorInsertFgfrR1 IIIc 15D8 (Fgfr1 Mouse)
ExpressionMammalianPromoterMoloney murine leukemia virus LTRAvailable SinceFeb. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVX Flag RagC S75N
Plasmid#112757Purposeexpress Flag-RagC (S75N mutant)DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only