We narrowed to 65,871 results for: des.1
-
Plasmid#177351PurposeAAV expression of scFV-fused catalytic domain of TET1 for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationN terminal domain of human Tet1PromoterCMV promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cav2.1 HA EI,II,III,IVA (E320A, E670A, E1411A, E1707A) pCAGGS
Plasmid#206115Purposeexpression of rat Cav2.1 with an exofacial double HA tag in domain II and mutations in the P loop of Domains I, II, III and IV which abolish trafficking to the cell surfaceDepositorInsertcacna1b (Cacna1a Rat)
ExpressionMammalianMutationE320A, E670A, E1411A, E1707APromoterCMV/B-actinAvailable SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/GFP4_Seq1.3
Plasmid#206136PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1 (Col1a1 Mouse)
ExpressionMammalianAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1471
Plasmid#143814PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-KPNA1 zeo
Plasmid#192329PurposeLentiviral expression vector for an inducible 3xFLAG-KPNA1DepositorAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-KPNA1
Plasmid#192304PurposeGateway entry vector for an inducible 3xFLAG-KPNA1DepositorAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpM-HsNot7-D40AE42A_AF
Plasmid#148675PurposeBacterial Expression of HsNot7-D40AE42ADepositorInsertHsNot7-D40AE42A (CNOT7 Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-TNFRSF6B-COMP5AP-AviTag-9xHis
Plasmid#157277PurposeMammalian expression of secreted protein fused to COMP5AP-AviTag-9xHis.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-TOX2
Plasmid#192920PurposeBarcoded piggybac transposon vector with Dox-inducible expression of TOX2DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3185
Plasmid#144661PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJL6
Plasmid#184134PurposeFor labelling (RFP) the apical region of the intestine. Translational fusion construct. coel::RFP_Pvha-6::vha-6::dsred.DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
FAM19A1-V5
Plasmid#184337PurposeExpression of V5-tagged mouse FAM19A1DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGWT35S-TIM21(1–50)-Citrine
Plasmid#182584PurposeTransient expression of TIM21(1–50)-Citrine in plant cell (Mitochondria)DepositorInsertTIM21(1–50)
TagsCitrineExpressionPlantPromoterCaMV 35S promoterAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-TOPO-kcnn3
Plasmid#164959PurposeZebrafish kcnn3 gene CDSDepositorInsertkcnn3 (kcnn3 Zebrafish)
UsePcr cloning vectorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-MAVS
Plasmid#158628PurposeGateway entry vector for an inducible 3xFLAG-tagged MAVSDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pelB-MBP-RevA-ss
Plasmid#137064PurposeE. coli expression clone (T7lac promoter) for mature RevA (aa 25-160) from B. burgdorferi with N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavageDepositorInsertAAF07416.1 (revA Borrelia burgdorferi B31)
TagsPelB signal peptide + His10 + maltose binding pro…ExpressionBacterialMutationlacks the RevA signal peptide and 5 residues (CKA…PromoterT7lacAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-REG1-CDS
Plasmid#136053PurposeREG1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (TATGGGATCAAGTGCCGATTC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.CB7.CI.ACY1-flag.WPRE.rBG
Plasmid#132686PurposeAAV plasmid encoding mouse ACY1 with C-terminal flag tagDepositorAvailable SinceNov. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBT3043
Plasmid#122546PurposeExpression of a C. elegan codon optimized florescent protein (CemOrange2) fused to a autophagic localized gene that is orthologus to mamalian LC3 (sqst-1) under the intestinal specific promoter nhx-2DepositorAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBT2999
Plasmid#122535PurposeExpression of a C. elegan codon optimized fluorescent protein (CemOrange2) fused to a lysosome localized gene (lmp-1) under the intestinal specific promoter nhx-2DepositorAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only