We narrowed to 36,703 results for: ELL
-
Plasmid#169249PurposeAAV transfer plasmid for neuronal expression of soma-targeted (RL-10, ribosomal tag) jGCaMP8f, with a flexible GS-linker sequence attaching the ribosomal tag to the jGCaMP8f protein.DepositorInsertRiboL1-jGCaMP8f
UseAAVTags6xHisExpressionMammalianPromoterhSynAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDmAct5C::Cas9-2A-Neo
Plasmid#176679PurposeExpression of Drosophila codon optimized spCas9 under Drosophila Act5C promoterDepositorInsertspCas9; NeoR (aminoglycoside phosphotransferase from Tn5)
UseCrisprExpressionInsectMutationDrosophila codon optimizedPromoterD. melanogaster Act5CAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19_dTAG-KANSL3-targeting
Plasmid#170755PurposeDonor plasmid for BSD-P2A-2xHA-dTAG knock-in into the N-terminus of the mouse Kansl3 locusDepositorInsertBSD-P2A-2xHA-dTAG
UseMouse TargetingTagsBSD-P2A-2xHA-dTAGMutationPhenylalanine 36 to valine in FKBP12Available SinceJune 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
(565) pAAV Alb-AAT KRAB-SadCas9 U6-gSTOP
Plasmid#163030PurposeExpression of CRISPRi with gSTOP gRNADepositorInsertMammalian codon-optimized SadCas9
UseAAVTagsKRAB, SV40 pA, and myc NLSExpressionMammalianPromoterAlb-AATAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
C1-FT-mCitrine-EEVEE-CaaX
Plasmid#155225PurposeMPAct with increased linker flexiblityDepositorInsertF-tractin (aa 9-52 of rat ITPKA) fused to mCitrine C-term tagged with a codon optimized EEVEE and CaaX seq derived from Kras4b
TagsmCitrineExpressionMammalianAvailable SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN441
Plasmid#137873PurposePiggyBac vector for expression of 3xgRNA targeting TCF4 for CRISPRi; mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Plxna3-Fc-His
Plasmid#72124PurposeExpresses the extracellular region of the PlexinA3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema4d-Fc-His
Plasmid#72157PurposeExpresses the extracellular region of the Sema4D protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEYFPC1-ECFP/GgVcl 1-419 control 1 FRET
Plasmid#46277DepositorAvailable SinceAug. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
-962 human cyclin D1 promoter EtsB site mutant pGL3Basic
Plasmid#32730DepositorInsertCCND1 (CCND1 Human)
UseLuciferaseMutation-778 EtsB binding site AGGAA deletionPromoter-962 CCND1Available SinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-LOC652799
Plasmid#23394DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pIS1 DICER1 short UTR
Plasmid#21648DepositorAvailable SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
-
pLPC-NFLAG TRF1 deltaA
Plasmid#16063DepositorAvailable SinceNov. 9, 2007AvailabilityAcademic Institutions and Nonprofits only -
pGL2 p15 4xSBR2 MutSBE
Plasmid#15707DepositorInsertp15 4xSBR2 (CDKN2B Human)
UseLuciferaseExpressionMammalianMutationMutant SBE (Smad binding element)Available SinceSept. 7, 2007AvailabilityAcademic Institutions and Nonprofits only -
pUC19 PKC epsilon
Plasmid#8442DepositorInsertMouse Protein Kinase C epsilon (Prkce Mouse)
ExpressionBacterialAvailable SinceApril 28, 2006AvailabilityAcademic Institutions and Nonprofits only -
pY113 (pcDNA3.1-huPb2Cpf1)
Plasmid#92272PurposeExpression of humanized Pb2Cpf1DepositorInserthuPb2Cpf1
TagsNLS and NLS-3xHAExpressionMammalianAvailable SinceJune 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHR-flag-GFP-JAM-B
Plasmid#205191PurposeThis vector encodes of a synCAM (JAM-B) and GFPDepositorInsertsynCAM JAM-B and GFP
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2_mSTING_scrambled_gRNA_2
Plasmid#196628PurposeScrambled control 2 for STING knock-out in murine cells.DepositorInsertmSTING scrambled gRNA 2
UseCRISPR and LentiviralMutationWTAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only