We narrowed to 13,341 results for: LIC
-
Plasmid#192288PurposeExpresses RFP and four sgRNAs against GBX2DepositorAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-HA-Dre]-lox-Akna-mOrange2
Plasmid#196893PurposeNeuron-specific expression of Akna fused to mOrange2. Used in combination with Talpha1-iCre-pA plasmidsDepositorAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-iCre-pA]-lox-Akna-mOrange2
Plasmid#196880PurposeNeuron-specific expression of the centrosomal protein Akna fused to mOrange2DepositorAvailable SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-iCre-pA]-lox-2xHA-128-425-Akap9
Plasmid#196897PurposeNeuron-specific expression of fragment 128-425 from A-Kinase Anchoring Protein 9 (Akap9) fused to 2xHA-tags.DepositorAvailable SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-HA-Dre]-lox-mOrange2-NEDD1-gTBD
Plasmid#196894PurposeNeuron-specific expression of the gamma-tubulin-binding domain (gTBD) of NEDD1 fused to mOrange aimed to displace endogenous gamma-TuRC from the centrosome. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsertN-gTBD-mOrange2 (NEDD1 Human)
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-Dre-PA]-lox-2xHA-CAMSAP3
Plasmid#196895PurposeNeuron-specific expression of Calmodulin Regulated Spectrin Associated Protein Family Member 3 (CAMSAP3) fused to 2xHA-tags. Used in combination with Talpha1-iCre-pA plasmidsDepositorAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-mOrange2-Cdk5rap2-CTD
Plasmid#196855PurposeExpression of the centrosome targeting carboxy-terminal domain (CTD) of Cdk5rap2 fused to mOrange2. Used to displace endogenous Cdk5rap2 from centrosomes.DepositorInsertmOrange2-Cdk5rap2-CTD (Cdk5rap2 Discosoma sp.)
ExpressionMammalianMutationNone (wt)PromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-AcGFP-Cdk5rap2-CTDdeltaCBD
Plasmid#196856PurposeExpression of the centrosome targeting carboxy-terminal domain (CTD) laking the centrosome binding domain (deltaCBD) of Cdk5rap2 fused to AcGFP. It cannot displace Cdk5rap2 from centrosomesDepositorInsertAcGFP-Cdk5rap2-CTDdeltaCBD (Cdk5rap2 Rat)
ExpressionMammalianMutationLacking the centrosome-targeting domain (CTD)PromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-Myc-PSK2 (1-416) (K57A)
Plasmid#197124PurposeExpression of kinase-deficient Myc-tagged PSK2 (aa1-416, K57A) / TAOK1 (aa1-416, K57A) in mammalian cellsDepositorInsertTAOK1 (aa1-416, K57A) (TAOK1 Human)
TagsMycExpressionMammalianMutationChanged K 57 to A and deleted C-terminusPromoterSV40Available SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-F479L
Plasmid#195477PurposepInducer21 plasmid containing the human MEFV gene with the F479L mutation (associated with Familial Mediterranean Fever) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationchanged phenylalanine 479 to leucineAvailable SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-ΔPYD
Plasmid#195478PurposepInducer21 plasmid containing the human MEFV gene with a deletion of residues 1 - 92 (the resulting pyrin protein lacks the PYD domain) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationdeletion of residues 1-92 of pyrin (the PYD domai…Available SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer21-3xFlag-hMEFV-Q426R
Plasmid#195475PurposepInducer21 plasmid containing the human MEFV gene with the Q426R mutation (associated with Familial Mediterranean Fever) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationchanged glutamine 426 to arginineAvailable SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLED.CaRPv1
Plasmid#193018PurposeExcitatory/Inhibitory neuron calcium indicator (hSyn promoter, Synrg exon, jRGECO1a/jGCaMP7b)DepositorInsertBichromatic calcium indicator (jGCaMP7b and jRGECO1a)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLED.RAB
Plasmid#193015PurposePhotoreceptor-specific reporter (CBh promoter, Atp1b2 exon, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
IL2-mCherry-AHA740D, E758K in pmCherryN1
Plasmid#187285PurposeExpress IL2-AH A740D, E758K-mCherryDepositorTagsmCherryExpressionMammalianMutationAH A740D, E758KPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-C-6His-mRplp1
Plasmid#173153Purposemouse Ribosomal Protein Lateral Stalk Subunit P1 (Rplp1) expression plasmid in mammalian cellsDepositorInsertORF clone Ribosomal Protein Lateral Stalk Subunit P1 (Rplp1) (Rplp1 Mouse)
TagsHisExpressionMammalianMutationWild typeAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E7-D192D
Plasmid#154024PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 7 c.576C>T, p.D192D (Synonymous Mutation)DepositorInsertBAP1 Exon 7 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.576C>T, p.D192DAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only