We narrowed to 13,991 results for: CAR
-
Plasmid#158240PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.AU1.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(BsmBI)-EF1a-BFP-BSD-Dmap1(SDM)
Plasmid#117139PurposeExpression vector encoding BFP-BSD-HA-Dmap1 resistant against gRNA encoded by pKLV2-U6(gDmap1 v4)--PGK-Puro-BFPDepositorInsertHA-Dmap1 (mutagenised) (Dmap1 Synthetic)
UseLentiviralTagsHAExpressionMammalianMutationmodified BFP, modified Dmap1 CDSPromoterhuman U6 promoter, human EF1a promoterAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.V5.VSVg_NGFR
Plasmid#158246PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.V5.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.FLAG.VSVg_NGFR
Plasmid#158247PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.V5.FLAG_NGFR
Plasmid#158251PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.V5.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-PHB-6
Plasmid#122232PurposeExpresses shRNA targeting the coding sequence of human PHBDepositorInsertshRNA targeting PHB (see partial depositor seq) (PHB1 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_9
Plasmid#60295PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.V5.HA_NGFR
Plasmid#158339PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.V5.HAMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEMS1401
Plasmid#29198PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving an EGFP reporterDepositorAvailable SinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.AU1.C_NGFR
Plasmid#158314PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.AU1.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1076 - prRosa26v1 LSL FLAG-SpCas9n NeoR
Plasmid#113162PurposeA donor plasmid with homologous arms matching rat Rosa26 and expressing a Cre-dependent FLAG-tagged SpCas9n and a NeoR selectable markerDepositorInsertSpCas9
TagsFLAGExpressionMammalianMutationD10APromoterCAGAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A_mmFbxw7a (closed)
Plasmid#160101PurposeExpresses murine Fbxw7 alpha in mammalian cellsDepositorAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-hAsCas12a(E174R/S542R)-NLS(nucleoplasmin)-6xHis (AAS1880)
Plasmid#114071PurposeT7 promoter bacterial expression plasmid for human codon optimized AsCas12a(E174R/S542R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized AsCas12a (E174R/S542R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationE174R and S542RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_TH1477_2xUGI_3xHA
Plasmid#136659PurposeExpresses St1BE4max-TH1477 in mammalian cells along with its U6-driven sgRNADepositorInsertsUseCRISPR and Synthetic BiologyTags2xUGI, APOBEC-1, SV40 NLS, UGI, and hSt1Cas9ExpressionMammalianPromoterCAG and U6Available SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
CRY2low-mCherry-Raf1
Plasmid#104066PurposeExpresses fusion of CRY2low mutant (CRY2 aa1-491 R489E A491D) with mCherry and Raf1DepositorExpressionMammalianMutationCRY2 aa 1-491 truncation, R489E A491DPromoterCMVAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMVblast_SLC38A2_N82A
Plasmid#156181PurposeCMV-driven expression of sgRNA-resistant SLC38A2 N82A mutant cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterCMVAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pInducer20_SLC38A2_N82A
Plasmid#156183PurposeDox-inducible expression of sgRNA-resistant SLC38A2 N82A mutant cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterTREAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
px330-Apob-2
Plasmid#162549PurposesgRNA targeting ApobDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330-Apob-1
Plasmid#162548PurposesgRNA targeting ApobDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only