We narrowed to 14,951 results for: RING;
-
Plasmid#172867PurposeExpresses mitochondrial targeting domain-pFAST in mammalian cellsDepositorInsertmito-pFAST
TagsMyc tag (C terminal on insert)ExpressionMammalianPromoterCMVAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s)
Plasmid#47868PurposeThis plasmid contains expression cassette for NmCas9 with N and C NLS and an HA tag, a cassette for expression of tracrRNA, a cassette for cloning crRNA under the control of U6 promoter.DepositorInsertsNmCas9
U6pr-tracrRNA
UseCRISPRTagsHA and NLSExpressionMammalianPromoterEF1a and U6Available SinceSept. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-GRAB_rDA-mut
Plasmid#140558PurposeExpresses the red fluorescent DA-insensitive control sensor GRAB_rDA-mut in neuronsDepositorHas ServiceAAV9InsertRed fluorescent DA-insensitive sensor GRAB_rDA-mut (control sensor)
UseAAVPromoterhSynAvailable SinceJuly 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134-STU-Lb
Plasmid#138105PurposeGolden Gate entry vector for 4th crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133-STU-Lb
Plasmid#138102PurposeGolden Gate entry vector for 3rd crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132-STU-Lb
Plasmid#138099PurposeGolden Gate entry vector for 2nd crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
TPC2-mCherry
Plasmid#135183PurposeExpresses TPC2 with C-terminus mCherry tag in mammalian cellsDepositorAvailable SinceJan. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
p221- purVSG117UTR
Plasmid#59732PurposeInserts a puromycin resistance gene and a VSG117 gene into the VSG221 expression site of T.brucei downstream of the expression site promoter.DepositorInsertVSG117 flanked upstream and downstream by sequences homologous to the VSG221 expression site
UseFor homologous recombination into vsg221 expressi…Available SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
OSC_Reporter_UAS_traffic jam_BoxB_d2eGFP_t2a_Blast
Plasmid#128010Purposetraffic jam enhancer driven GFP_P2A-Blasticidin-resistance harboring 10 intronic boxB sites and 14 upstream UAS sitesDepositorInserttraffic jam enhancer driven GFP_P2A-Blasticidin-resistance harboring 10 intronic boxB sites and 14 upstream UAS sites
UseDrosophila osc reporter constructAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ144-ZmUbi-pT
Plasmid#138108PurposeGolden Gate recipient and Gateway entry vector; assembly of 4 gRNAs driven by Zea mays Ubi promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-FKBP-TPD54
Plasmid#172454PurposeExpression of Tumor Protein D52 like 2 (TPD54/TPD52L2) with N-terminal GFP-FKBP tagDepositorAvailable SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-Scal-T2A-EGFP-Puro
Plasmid#234949PurposeDoxycycline-inducible mitochondria-localized ScaI expressing plasmidDepositorInsertScaI restriction enzyme with N-terminal COX8 mitochondrial localization signal
UseLentiviralTagsFLAGExpressionMammalianPromotertight TRE promoterAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-ApaLI-T2A-EGFP-Puro
Plasmid#234948PurposeDoxycycline-inducible mitochondria-localized ApaLI expressing plasmidDepositorInsertApaLI restriction enzyme with N-terminal COX8 mitochondrial localization signal
UseLentiviralTagsFLAGExpressionMammalianPromotertight TRE promoterAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV CMV mCherry-DDX1-V5
Plasmid#175162PurposeLentiviral expression of human DDX1-V5DepositorAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO-GCaMP6f
Plasmid#128315PurposeExpresses GCaMP6f under control of eukaryotic Ef1a promoter after Flp-dependent recombination.DepositorHas ServiceAAV1InsertGCaMP6f
UseAAVTagsHis TagExpressionMammalianPromoterEf1aAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC78
Plasmid#62339PurposesgRNA + 1x COM with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: CATACTTCTGCCTGCT…PromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQ142-ZmUbi
Plasmid#138106PurposeGolden Gate recipient and Gateway entry vector; assembly of 2 gRNAs driven by Zea mays Ubi promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SF3B1-K700E-reporter
Plasmid#200318PurposeA fluorescent reporter for SF3B1 K700E mutation. Co-expresses a blasticidin resistance gene for selection. Includes LoxP sites for Cre-mediated deletion of reporter cassette.DepositorInsertBSD-2A-EGFPi
UseLentiviralExpressionMammalianPromoterEF1-aAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
TPC1-mCherry
Plasmid#135182PurposeExpresses TPC1 with C-terminus mCherry tag in mammalian cellsDepositorAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only