We narrowed to 29,100 results for: Tat
-
Plasmid#191756PurposeExpression of N-terminally mGFP labelled mutated FGFR3 (isoform IIIc)-K650Q mutation (associated with HCH; target mutation: c.1948A>C; silent mutation added on purpose: c.1938C>T)DepositorInsertmGFP-FGFR3IIIc
TagsmGFPExpressionMammalianMutationc.1948A>C (p.K650Q) + silent mutation c.1938C&…Available SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_mGFP-FGFR3-K650E
Plasmid#191757PurposeExpression of N-terminally mGFP labelled mutated FGFR3 (isoform IIIc)-K650E mutation (associated with TD2; target mutation: c.1948A>G; silent mutation added on purpose: c.1938C>T)DepositorInsertmGFP-FGFR3IIIc
TagsmGFPExpressionMammalianMutationc.1948A>G (p.K650E) + silent mutation c.1938C&…Available SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_mGFP-FGFR3-G380R
Plasmid#191755PurposeExpression of N-terminally mGFP labelled mutated FGFR3 (isoform IIIc)-G380R mutation (associated with ACH; target mutation: c.1138G>A; silent mutation added on purpose: c.1131C>T)DepositorInsertmGFP-FGFR3IIIc
TagsmGFPExpressionMammalianMutationc.1138G>A (G380R) + c.1131C>T (silent mutat…Available SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLY152
Plasmid#130950Purposedcas9 generator and reporter circuit (PpspA-2G6 with sfgfp::ASV)DepositorInsertsdcas9
tetR
sfgfp
UseSynthetic BiologyTagsASV tagExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterPpspA-2G6 and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_mGFP-FGFR3-Y373C
Plasmid#191754PurposeExpression of N-terminally mGFP labelled mutated FGFR3 (isoform IIIc)-Y373C mutation (associated with TD1) (target mutation: c.1118A>G ; silent mutation added on purpose: c.1110C>A)DepositorInsertmGFP-FGFR3IIIc
TagsmGFPExpressionMammalianMutationc.1118A>G, p.Y373C + c.1110C>A (silent muta…Available SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-Q769-QES.i03.c04-754*
Plasmid#123228PurposeMammalian expression plasmid for Env from the Q769.d22 HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (Q769.d22) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-Q842-QES.i04.c05-754*
Plasmid#123232PurposeMammalian expression plasmid for Env from the Q842.d12 HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (Q842.d12) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGF-GAS4X
Plasmid#225751PurposeThis plasmid was designed to selectively monitor the activation of the STAT1 signaling pathway in NK cells, a pathway known to play a crucial role in regulating NK cells' activation.DepositorAvailable SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAD29_hIRG1_4-461_pvp008
Plasmid#124843PurposeExpresses human CAD (Irg1) in E.coliDepositorInsertcis-aconitate decarboxylase (ACOD1 Human)
TagsStrepTag and TEV siteExpressionBacterialMutationdeleted amino acids 1-3 and 462-end.PromoterT7Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAD39_mIRG1_4-462_pvp008
Plasmid#124873PurposeExpresses mouse CAD (Irg1) in E.coliDepositorInsertcis-aconitate decarboxylase (Acod1 Mouse)
TagsStrepTag and TEV siteExpressionBacterialMutationdeleted amino acids 1-3 and 463-end.PromoterT7Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
GPX8 rescue PLAK1
Plasmid#161517PurposeRescues the expression of GPX8 in GPX8 plenti-CRISPR KO cellsDepositorAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-Lb
Plasmid#209028PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-As
Plasmid#209032PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_SMAD-FOS_Mutant
Plasmid#194188PurposeIncludes the promoter (1kb) of SMTS with mutated SMAD/FOS binding siteDepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated SMAD/FOS Site, Region 3-15nt of 1000ntPromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_6
Plasmid#155064PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_5
Plasmid#155063PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_shRNA resistant nmPKA-Cα-mEGFP
Plasmid#114144PurposeThe G2A mutant of the mouse PKA catalytic subunit α C-terminally tagged by monomeric mEGFP. Silent mutations were introduced to make it resistant to shRNA knock-down.DepositorInsertmouse PKA Cα-mEGFP with G2A mutation and silent mutation to resist shRNA knockdown (Prkaca Mouse)
ExpressionMammalianMutationG2A mutation and silent mutation to resist shRNA …Available SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CA-RIT-NFAT1 (IRES-GFP)
Plasmid#85181PurposeConstitutively active NFAT1, mutated to interfere selectively with the NFAT:AP-1 interaction. Co-expresses EGFP for selectionDepositorInsertCA-RIT-NFAT1 (Nfatc2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationAmino acids 1-3 removed; CA: PASSGSSASF mutated t…Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST53-LRRK2-3XKD
Plasmid#25049DepositorInsertLRRK2 (LRRK2 Human)
TagsGFPExpressionMammalianMutation"Kinase Dead" Lysine 1906 mutated to A…Available SinceJune 17, 2010AvailabilityAcademic Institutions and Nonprofits only