-
Plasmid#62256Purposeexpression of A1T sgRNA from the arabinose-inducible promoterDepositorInsertA1T sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A4NT
Plasmid#62261Purposeexpression of A4NT sgRNA from the arabinose-inducible promoterDepositorInsertA4NT sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dgcr8_4
Plasmid#73528PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorInsertDGCR8
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A3NT
Plasmid#62259Purposeexpression of A3NT sgRNA from the arabinose-inducible promoterDepositorInsertA3NT sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp4
Plasmid#238037PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp2
Plasmid#238035PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp3
Plasmid#238036PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp6
Plasmid#238039PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp5
Plasmid#238038PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYAMTr2GCsgScLEU2
Plasmid#224868PurposeDisruption of S. cerevisiae type LEU2 geneDepositorInsertpYAMTr2GC having the guide sequence ScLEU2 (LEU2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
3xMS2 TR knockin sgRNA 1
Plasmid#207607PurposesgRNA for homology directed repair insertion of 3xMS2-TR-100-PURO into the endogenous TR locusDepositorInsertcgactcgcccggcagcgcac
UseTagsNoneExpressionMammalianMutationPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Merry Target 3- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210743PurposeCoding for SaSp Cas9 alongside Merry sgRNA targeting GFP Target 3DepositorInsertsSaSp Cas9
Merry sgRNA GFP Target 3
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 4- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210748PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 4DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 4
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 2- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210746PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 2DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 2
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1- sgCTG Bilbo -eCMV-CjSpD8A-3XFLAG-SV40 NLS-ITR2
Plasmid#210749PurposeCoding for CjSp D8A alongside Bilbo sgRNA targeting CAG repeatsDepositorInsertsCjSp D8A Cas9
Bilbo sgCAG
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationD8A, N-terminal Cj Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 2- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210738PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 2DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationPromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 4- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210740PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 4DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationPromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
OA-1067L
Plasmid#200253PurposepBac-U6-gRNA(doublesex+Intersex+bTublin)-3xp3-tdTomatoDepositorInsert6 gRNAs targeting Doublesex, Intersex, bTublin
UseTagsExpressionInsectMutationPromoterAvailable sinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRTagsExpressionMutationPromotermouse U6Available sinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only