We narrowed to 4,446 results for: gca
-
Plasmid#228762PurposePlasmid expressing Cas9 and 2 gRNAs for mouse Pkd2. Use for disruption of mouse Pkd2 in cultured cells.DepositorAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only
-
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS161
Plasmid#215683PurposeGuide only plasmid targeting chrIII split hygromycinR landing padDepositorInsertU6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS160
Plasmid#215682PurposeGuide only plasmid targeting chrI split hygromycinR landing padDepositorInsertU6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-shHsp90ab1 (#a)
Plasmid#206357PurposeAAV plasmid expressing HSP90AB1 shRNA in photoreceptorsDepositorInsertshRNA #a of Hsp90ab1
UseAAVPromoterhuman red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
E42_gControl_dTet_IRES_mTurquoise2
Plasmid#189799PurposeRetroviral delivery of control guide RNADepositorInsertLuciferase gRNA
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ssh2 gRNA#3
Plasmid#163399PurposeCas9-mediated knockout of Ssh2 in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBzCas13b-gRNA-2
Plasmid#164859PurposeConstitutive expression of single-spacer CRISPR array with spacer #2 targeting deGFP mRNA for BzCas13b in bacteria.DepositorInsertBzCas13b-gRNA-2
ExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLsCas13a-gRNA-2
Plasmid#164866PurposeConstitutive expression of single-spacer CRISPR array with spacer #2 targeting deGFP mRNA for LsCas13a in bacteria.DepositorInsertLsCas13a-gRNA-2
UseCRISPRExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-3'UTR
Plasmid#136042PurposeUPF3A shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GACGTAGAAACACGCAGAAAC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-CDS
Plasmid#136043PurposeUPF3A shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCAGAAACCATTCTAAAGAAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
EMX1*_sgRNA
Plasmid#100558PurposeExpresses EMX1* sgRNA. Target sequence: (G)GAGTCCGAGCAGAAGAAGAA. Same target sequence as #100555, except with an additional 5' G.DepositorInsertEMX1 sgRNA
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF792_1
Plasmid#86339PurposeEncodes gRNA for 3' target of human ZNF792DepositorInsertgRNA against ZNF792 (ZNF792 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-VR
Plasmid#62286Purposeexpression of VR sgRNA from the arabinose-inducible promoterDepositorInsertVR sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
MsMUT_sgRNA1
Plasmid#111296PurposeCRISPR KO murine MUTDepositorInsertsgRNA1 against murine MUT
UseCRISPR and LentiviralExpressionMammalianAvailabilityAcademic Institutions and Nonprofits only -
7b sgRNA for EJ7-GFP reporter
Plasmid#113624PurposesgRNA/CAS9 expression plasmid to induce the 3’ double-strand break in the EJ7-GFP reporterDepositorInsert7b sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GfaABC1D.PI.Lck-GFP.SV40
Plasmid#105598PurposeAAV expression of membrane bound EGFP from GfaABC1D promoterDepositorHas ServiceAAV5InsertLck-EGFP
UseAAVExpressionMammalianPromoterGfaABC1DAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKL004
Plasmid#98920PurposeConstitutively expresses the calcium sensor GCaMP6f tethered to mRuby3 under the Sigma 70 promoter in E. coli.DepositorInsertGCaMP6f tethered to mRuby
TagsHis and mRuby3ExpressionBacterialPromoterBBa_J23118 - Strong ConstitutiveAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB5191
Plasmid#126911PurposePlasmid containing gRNA expression cassettes targeting the X-4 and XII-5 integration sites in Saccharomyces cerevisiaeDepositorInsertX-4 and XII-5 gRNA
UseCRISPRAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAG-EGFP-Otx2shRNA1
Plasmid#73981PurposeOtx2 shRNA1 (mir155 backbone) was inserted into the 3'UTR of EGFP.DepositorInsertshRNA that targets the mouse Otx2 gene
ExpressionMammalianPromoterCAGAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only