We narrowed to 28,485 results for: Tat
-
Plasmid#102350PurposeLentiviral expressing translational fusion between blue fluorescent protein and Erk2 bearing the D319N mutationDepositorInsertErk2 (Mapk1 Mouse)
UseLentiviralTagsBFPMutationAspartic acid 319 was mutated to asparaginePromoterSFFVAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pC1GFP-Kir7.1
Plasmid#79118PurposeExpress N-terminal fused Kir7.1 protein in mammalian cellsDepositorInsertInwardly rectifying potassium channel KCNJ13 (KCNJ13 Human)
TagsGFPExpressionMammalianPromoterCMVAvailable SinceNov. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-TBG-FLAG-mRIPK1
Plasmid#115341PurposeLiver-specific adeno-associated viral delivery and mammalian expression of Flag-mRIPK1DepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Tom20-mChF-AIP(TA)
Plasmid#61513PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry, Tom20, and AIP with TA mutationDepositorInsertFK506 binding protein 1A (FKBP1A Human)
TagsAIP with TA mutation (see comments), Tom20, and m…ExpressionMammalianPromoterCMVAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLXC2B-PLAG1-3xFLAG
Plasmid#228057Purposelentiviral expression of human PLAG1 with 3xFLAG tagDepositorAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_intergenic-intergenic_2
Plasmid#155078PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-Human IntS6
Plasmid#198408PurposeExpresses FLAG-tagged human IntS6DepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{GCaMP6f}on-WPRE
Plasmid#111393PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection) and Cre-ON GCaMP6f (ultrasensitive calcium sensor)DepositorInsertsUseAAVTags6xHis, Myc, T7, and XpressExpressionMammalianPromoterhSynapsinAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-SARS2-S-G614 (C-flag)
Plasmid#156421PurposeMammalian expression of SARS-CoV-2 S protein (G614) with the flag tag at C-terminus. Pseudotypes onto the MLV vector but not efficiently to VSV or lentiviral vectors.DepositorInsertSARS-CoV-2 S protein (S SARS CoV2)
TagsFlagExpressionMammalianMutationD614GPromoterCMVAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 sequence: GTCGCTACCTACAGCCAGGA, Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Cdkn1a_i1-ipUSEPR-TR657
Plasmid#228953PurposeKnockdown of Cdkn1a in mammalian cellsDepositorInsertsg_Cdkn1a_i1 (Cdkn1a Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG CMV14 / BRAF-D594G
Plasmid#131719PurposeMammalian Expression of Flag tagged BRAFDepositorAvailable SinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgCtrl#1
Plasmid#174142PurposeLentiviral vector expressing a control sgRNA that targets a safe harbor siteDepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Chrimson-GFP
Plasmid#62718PurposeAAV-mediated expression of Chrimson-GFP under the CaMKII promoter. Using SV40pA signal.DepositorInsertChrimson-GFP
UseAAVTagsGFPExpressionMammalianPromoterCaMKIIAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pL452-Sf3b1-K700E
Plasmid#90425Purposeselectable HDR vector to introduce K700E mutation within mus Sf3b1 gene (for use with sgSf3b1(T1) and pL452(hygro)-Sf3b1-K700K plasmids enabling generation of hemizygous K700E mutation)DepositorInsertSf3b1 - left and right homology arms (Sf3b1 Mouse)
UseHomology-directed repair vectorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{ChETA}on-WPRE
Plasmid#111388PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection) and Cre-ON ChETA (for optogenetic activation)DepositorAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
Gfp-zf-vasa
Plasmid#167323PurposePlasmid for synthesis of GFP chimeric RNA that contained vasa-3'UTRs of zebrafish by in vitro transcription.DepositorInsertzf vasa 3'UTRs (ddx4 Zebrafish)
ExpressionBacterialAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Chronos-GFP
Plasmid#99232PurposeAAV-mediated expression of Chronos-GFP under the CAG promoter. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterCAGAvailable SinceDec. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-UBXD8-Strep-HA
Plasmid#113477PurposeExpression of human UBXD8 with C-terminal strep-HA tagDepositorInsertUBXD8 (FAF2 Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-NMHC-IIA-S1916A
Plasmid#101040PurposeExpresses GFP-MYH9 construct (human myosin IIA) carrying mutation of serine 1916 to alanine, driven by CMV promoter. Thus inhibits PKC phosphorylation of the tail. Also carries S1915A mutation.DepositorInsertNon-muscle myosin IIA heavy chain (MYH9 Human)
TagsGFPExpressionMammalianMutationS1916A, S1917APromoterCMVAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only