We narrowed to 5,947 results for: crispr cas9 expression plasmids
-
Plasmid#85451PurposeExpress sgRNA in mammalian cellsDepositorInsertpCMV-EGFP
UseAAVPromoterpCMV-EGFPAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
AP54-5
Plasmid#65599Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APs12
UseCRISPRExpressionWormPromoterU6Available SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-6
Plasmid#65593Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-5
Plasmid#65591Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-8
Plasmid#65596Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-7
Plasmid#65594Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP54-3
Plasmid#65597Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APs12
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTetO-hOSK-CASH-1
Plasmid#188977PurposeA CASH-1 GSH targeting, doxycycling inducible humanized Oct4, Sox2, and Klf4 expressing CRISPR/Cas9 donor plasmid.DepositorInsertDoxycycline inducible reprogramming donor cassette
ExpressionMammalianAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBLO1811_arC9_noNLS_human
Plasmid#74494PurposeHuman codon optimized plasmid to express arC9 t2a mCherry w/o NLS and a sgRNADepositorInsertarC9
UseCRISPRTagst2a mCherry (C-terminal on insert)ExpressionMammalianAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Nat
Plasmid#232097PurposeYeast CEN plasmid for galactose-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with NatMX selectionDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Kan
Plasmid#232099PurposeYeast CEN plasmid for galactose-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with KanMX selectionDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Hyg
Plasmid#232098PurposeYeast CEN plasmid for galactose-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with HygMX selectionDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
BPK1520
Plasmid#65777PurposeHuman expression plasmid for SpCas9 sgRNA (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-Sp-sgRNADepositorInsertSpCas9 gRNA backbone, without spacer sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSc1
Plasmid#80436PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRExpressionMammalianPromoterCMV and U6Available SinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSc2
Plasmid#80437PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRExpressionMammalianPromoterCMV and U6Available SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV537
Plasmid#177704PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC gRNA Shuttle
Plasmid#47024PurposeEncodes a template from which gRNAs can be made via InFusion cloning. The Medicago truncatula U6.6 promoter drives the gRNA. For use in plants.DepositorInsertgRNA Shuttle
UseCRISPR; Cas9ExpressionPlantMutationG to T cloning mutation at position 323PromoterMedicago truncatula U6.6Available SinceSept. 3, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEG302 22aa SunTag NtDRMcd (no NLS) g4+g10+g18 (FWA)
Plasmid#117168PurposeCRISPR Cas9 SunTag system to target NtDRMcd (without an NLS) to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_NLS_GB1_noNLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZBTB12.1.0-gDNA
Plasmid#113769PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB12DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSPDEF.1.0-gDNA
Plasmid#113796PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor SPDEFDepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZBTB17.1.0-gDNA
Plasmid#112483PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB17DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMLX.1.0-gDNA
Plasmid#112466PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MLXDepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTFCP2.1.0-gDNA
Plasmid#112404PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TFCP2DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMSX2.1.0-gDNA
Plasmid#113793PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MSX2DepositorAvailable SinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTOX2.1.0-gDNA
Plasmid#113787PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TOX2DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTSHZ2.1.0-gDNA
Plasmid#113778PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TSHZ2DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTCFL5.1.0-gDNA
Plasmid#113775PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TCFL5DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only