We narrowed to 10,841 results for: esp
-
Plasmid#234737PurposeAll-in-one CRISPR/Cas9 vector encodes high-fidelity eSpCas9 and a gRNA targeting Nrl, efficiently reprogramming rod precursors into cone-like cells in the mouse retina.DepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLCHKOv3-mClover-intergenic-As
Plasmid#209036PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_2-As
Plasmid#218814PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_3-As
Plasmid#218815PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_4-As
Plasmid#218816PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_V5-TWIST1_NEUROD1L
Plasmid#215043PurposeMammalian expression of human TWIST1 (with fragment of loop from NEUROD1)DepositorInserttwist family bHLH transcription factor 1 (TWIST1 Human)
TagsV5ExpressionMammalianMutationLeft portion of TWIST1 bHLH loop (aa137-139, TLP)…PromoterCMVAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_V5-TWIST1_NEUROD1R
Plasmid#215044PurposeMammalian expression of human TWIST1 (with fragment of loop from NEUROD1)DepositorInserttwist family bHLH transcription factor 1 (TWIST1 Human)
TagsV5ExpressionMammalianMutationRight portion of TWIST1 bHLH loop (aa139-141, PSD…PromoterCMVAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_V5-TWIST1_NEUROD1M
Plasmid#215045PurposeMammalian expression of human TWIST1 (with fragment of loop from NEUROD1)DepositorInserttwist family bHLH transcription factor 1 (TWIST1 Human)
TagsV5ExpressionMammalianMutationMiddle portion of TWIST1 bHLH loop (aa139, P) rep…PromoterCMVAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-miRFP670-eDHFR(69K6)-G-alpha-s
Plasmid#172105PurposeMammalian expression of Gαs fused to miRFP670-eDHFR(69K6)DepositorAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
Bxb1Donor_G315T_ADRB2_LucReporter
Plasmid#129793Purposeencodes a donor vector for recombination with the Bxb1 recombinase with variant G315T of the Beta-2 Adrenergic Receptor and a cAMP-responsive luciferase reporter geneDepositorInsertADRB2 (ADRB2 Human)
UseSynthetic BiologyTags3x FLAGExpressionMammalianMutationG315TPromoterN/AAvailable SinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
Bxb1Donor_W99A_ADRB2_LucReporter
Plasmid#129789Purposeencodes a donor vector for recombination with the Bxb1 recombinase with variant W99A of the Beta-2 Adrenergic Receptor and a cAMP-responsive luciferase reporter geneDepositorInsertADRB2 (ADRB2 Human)
UseSynthetic BiologyTags3x FLAGExpressionMammalianMutationW99APromoterN/AAvailable SinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
Bxb1Donor_N51L_ADRB2_LucReporter
Plasmid#129790Purposeencodes a donor vector for recombination with the Bxb1 recombinase with variant N51L of the Beta-2 Adrenergic Receptor and a cAMP-responsive luciferase reporter geneDepositorInsertADRB2 (ADRB2 Human)
UseSynthetic BiologyTags3x FLAGExpressionMammalianMutationN51LPromoterN/AAvailable SinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-ELP-ddFLN4-XMod-Doc-HIS (BMA-KO)
Plasmid#153440PurposeE. coli expression of Rc. XDocB binding mode A knock-out construct containing ybbr tag, ELP linker and ddFLN4 fingerprint domain. This construct was designed for AFM measurements.DepositorInsertRc. XDocB binding mode A knock-out mutant
Tags3xELP linker, 6xHis, ddFLN4 fingerprint domain, a…ExpressionBacterialMutationArginine 191 and leucine 195 on XDocB were mutate…PromoterT7 promoterAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
EGFP-p300 (D1399Y)
Plasmid#191763PurposeExpression of EGFP fused to catalytically dead core p300 histone acetyltransferase (D1399Y)DepositorInsertFRB-EGFP-p300 core (D1399Y) (EP300 Human)
TagsEGFP (N-terminal of p300 core (D1399Y)) and FRB (…ExpressionBacterial and MammalianMutationcatalytic D1399Y mutation in p300PromoterEF1alphaAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDY0181 Cargo EGFP with AttP Bxb1 site (Parent minicircle)
Plasmid#179115PurposeCargo EGFP with AttP Bxb1 site (Parent minicircle)DepositorInsertCargo EGFP with AttP Bxb1 site
UseCRISPRAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pinducer 20 DN-KASHΔPPPL
Plasmid#129280PurposeTet-ON inducible lentivirus expressing mcherry-labeled DN KASHΔPPPLDepositorInsertSYNE1 (SYNE1 Human)
UseLentiviralTagsmcherryMutationthe last 4 amino acids (PPPL) of the KASH domain …PromoterCMVAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 blast OFF 3xflag IREB2
Plasmid#169889PurposeExpress 3x flag IREB2, suppressible by doxycycline additionDepositorInsertIREB2 (IREB2 Human)
UseLentiviral; Doxycycline mediated suppressionTags3x FlagExpressionMammalianMutationSilent mutations in sgIREB2_1 and sgIREB2_2 targe…PromoterTREAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s(alpha3beta5/G226A/A366S)
Plasmid#55797PurposeThis highly effective dominant negative G protein alpha-s mutant contains, in addition to the mutations in alpha-s(alpha3beta5/G226A), the A366S mutation, which increases GDP release.DepositorInsertalpha-s (alpha3beta5/G226A/A366S) (Gnas Rat)
Tagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationN271K, K274D, R280K, T284D, I285T, G226A, A366S i…PromoterCMVAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRS3 (CK2alpha, CK2beta)
Plasmid#27092DepositorUseTetracycline-regulated expressionTagsHA and MycExpressionMammalianPromoterbidirectional tet-responsive promoterAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only