We narrowed to 12,975 results for: lic
-
Plasmid#120917PurposeExpresses His6-EX-HA-FRB-MBD in bacteria for protein purificationDepositorInsertHis6-EX-HA-FRB-MBD
ExpressionBacterialAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
SPIN2B (SPIN2BA-c011)
Plasmid#98238PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
OR gate
Plasmid#44451DepositorInsertOR-gate
UseSynthetic BiologyExpressionBacterialAvailable SinceMay 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRSETB-S28 histone 3 phosphorylation reporter
Plasmid#32788DepositorInsertCFP-14-3-3tau-H3 peptide-YFP
TagsCFP and YFPExpressionBacterialAvailable SinceNov. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAM-35s-CERK1 D441V-YFPc-1
Plasmid#102403Purposesplit YFP. Plant expression of CERK1 D441V-YFPc-1DepositorAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Mixed-signal integration BAC Reporter
Plasmid#78223Purposesynthetic gene circuitDepositorInsertsynthetic gene circuit
Available SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
HA-human-BNIP3 delta Exon(2+3)
Plasmid#100783PurposeMammalian expression of human-BNIP3 delta Exon2+3 splice variantDepositorInserthuman-BNIP3 delta Exon(2+3) (BNIP3 Human)
TagsHAExpressionMammalianMutationExon2 and Exon3 deletionPromoterCMVAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS2katGp-RBS33-TP901-proD-oxyR
Plasmid#78215Purposesynthetic gene circuitDepositorInsertsynthetic circuit
Available SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS1katGp-RBS31-PhiC31-proD-oxyR
Plasmid#78217Purposesynthetic gene circuitDepositorInsertsynthetic circuit
Available SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS2katGp-RBS31-PhiC31-proD-oxyR
Plasmid#78213PurposeSynthetic gene circuitDepositorInsertsynthetic circuit
Available SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
CSNK1G2
Plasmid#39150PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
Bxbi+PhiC31 GFP Bandpass BAC Reporter
Plasmid#78218Purposesynthetic gene circuitDepositorInsertsynthetic circuit
Available SinceMay 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBAC-T7-F7
Plasmid#234973PurposeA segment of the T7 phage genome was inserted into the artificial bacterial chromosome . The genome segment can be stably replicated in plasmid and can be genetically modified at the plasmid levelDepositorInsertT7-F7
ExpressionBacterialAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBAC-T7-F8
Plasmid#234974PurposeA segment of the T7 phage genome was inserted into the artificial bacterial chromosome . The genome segment can be stably replicated in plasmid and can be genetically modified at the plasmid levelDepositorInsertT7-F8
ExpressionBacterialAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBAC-T7-F6
Plasmid#234972PurposeA segment of the T7 phage genome was inserted into the artificial bacterial chromosome . The genome segment can be stably replicated in plasmid and can be genetically modified at the plasmid levelDepositorInsertT7-F6
ExpressionBacterialAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCTcon2-rHUH
Plasmid#235190PurposeTo display rHUH on yeast surfaceDepositorInsertrHUH
ExpressionYeastAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTetON-rHUH
Plasmid#235192PurposeTo express rHUH protein in mammalian cellsDepositorInsertrHUH
ExpressionMammalianAvailable SinceMarch 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCTcon2-rHUH(G5)
Plasmid#235188PurposeTo display rHUH(G5) on yeast surfaceDepositorInsertrHUH(G5)
ExpressionYeastAvailable SinceMarch 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTD68-rHUH
Plasmid#235194PurposeTo express rHUH-myc in bacteriaDepositorInsertrHUH
ExpressionBacterialAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only