We narrowed to 14,009 results for: SHI
-
Plasmid#47354PurposeClock fragment mutatation tagged with VenNDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, L57EPromoterCMVAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEN_hU6miR-Gb2-K
Plasmid#25759PurposeEntry vector with human U6 promoter driving both mouse G alpha 12 and G alpha 13 miR30-based shRNAs.DepositorInsertGb2 miR-shRNA (Gnb2 Mouse)
UseEntry vectorAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET28aAviHisCD72aCTLD
Plasmid#129065Purposegeneration of biotinylated mouse CD72a CTLD protein using bacteriaDepositorInsertCD72a (Cd72 Mouse)
ExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-puro-ARID1A
Plasmid#39478PurposeTetracycline-inducible lentiviral expression of human ARID1A; 3rd generation lentiviral vectorDepositorAvailable SinceSept. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pNK5785
Plasmid#219753PurposepGAP-like vector encoding mutant of Neonothopanus nambi luciferase nnLuz_v4 under control of GAP promoter, for yeast expressionDepositorInsertpGAP - nnLuz_v4 - tAOX
UseLuciferaseExpressionYeastAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK5712
Plasmid#219752PurposepGAP-like vector encoding mutant of Neonothopanus nambi hispidin-3-hydroxylase nnH3H_v2 under control of GAP promoter, for yeast expressionDepositorInsertpGAP - nnH3H_v2 - tAOX
ExpressionYeastAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK5867
Plasmid#219751PurposepGAP-like vector encoding hispidin-synthase from Mycena citricolor under control of GAP promoter, for yeast expressionDepositorInsertpGAP - mcitHispS - tAOX
ExpressionYeastAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK1508
Plasmid#219750PurposepGAP-like vector encoding Aspergillus nidulans 4'-phosphopantetheinyl transferase NpgA under control of GAP promoter, for yeast expressionDepositorInsertpGAP - npgA - tAOX
ExpressionYeastAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Rtn4a-GFP
Plasmid#61807PurposeHuman Rtn4a fluorescently tagged with GFP on the C-terminus for mammalian expressionDepositorInsertRtn4a (RTN4 Human)
TagsAcGFPExpressionMammalianMutationRtn4a Stop Codon removedPromoterCMVAvailable SinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits only