We narrowed to 57,331 results for: plasmid
-
Plasmid#194966PurposeThe plasmid expresses human codon-optimized Cas12j-8 and puromycin resistence gene.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only
-
AAV-mPGK-eGFP (beta-globin intron)
Plasmid#162513PurposeAAV vector plasmid expressing enhanced green fluorescent protein (eGFP) under the mouse phosphoglycerate kinase (mPGK) promoter that is upstream of a beta-globin intronDepositorInserteGFP
UseAAVExpressionMammalianPromotermPGKAvailable sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV2-SBECN1W
Plasmid#107937PurposeAdeno-Associated viral (AAV) vector plasmid expressing mouse Beclin-1 (BECN1) in neuronsDepositorAvailable sinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEMS2021
Plasmid#49128PurposeAAV plasmid with DCX (Ple302) promoter driving expression of iCre.DepositorInsertssAAV-Ple302-iCre
UseAAVExpressionMammalianPromoterDCXAvailable sinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1997
Plasmid#49127PurposeAAV plasmid with SLC6A4 (Ple198) promoter driving expression of iCre.DepositorInsertssAAV-Ple198-iCre
UseAAVExpressionMammalianPromoterSLC6A4Available sinceMay 7, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
MCP-EGFP-PiggyBac
Plasmid#190003PurposeExpression of MCP-EGFP in mammalian cells. To clone this plasmid, Addgene plasmid #119908 was used. We replaced the tandem coat proteins and double tagRFP with a single coat protein fused to EGFP.DepositorInsertMCP-EGFP
Available sinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEC3105 (pSpy1C-PxylS2_ffluc)
Plasmid#218512Purposereplicative E. coli-S. pyogenes shuttle plasmid, constitutive expression of firefly luciferase reporterDepositorInsertffluc
UseLuciferaseMutationdeletion of Plac_mrfp cassettePromoterPxylS2Available sinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
CAP-AAV.FUS.3
Plasmid#222333PurposeAAV.FUS.3 Rep-Cap plasmid for production of AAV.FUS.3, a capsid with tropism for CNS neurons upon focused ultrasound mediated delivery.DepositorInsertAAV9 modified with 7-amino acid insertion between AA position 588 and 589 of VP1
UseAAVPromoterp41Available sinceAug. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-dCas9/pMSCVhyg
Plasmid#134323PurposeExpresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.DepositorInsert3xFLAG-dCas9
UseCRISPR and RetroviralTags3xFLAG tag and NLSExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterLTRAvailable sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_KRAB-MeCP2_mcherry
Plasmid#167902PurposePiggyBac compatible plasmid expressing dCas9-KRAB-MeCP2 expression plasmidDepositorInsertdCas9-KRAB-MeCP2
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAVS1-TetOn-3XFLAG-firefly-beta-globin-PTC39-AAVS1
Plasmid#184397PurposeDonor plasmid for stable integration of firefly luciferase NMD(+) PTC39 reporter at AAVS1DepositorInsertFirefly luciferase beta-globin-PTC39
UseCRISPR; Donor plasmid for hdrTags3X FLAGExpressionMammalianMutationPTC in beta-globin at amino acid position 39PromoterTet-On 3GAvailable sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-G12-CheRiff-T2A-mCherry
Plasmid#170275PurposeCheRiff-T2A-mCherry construct expression in mammlian cells. pAAV vector. Reporter plasmid.DepositorInsertCheRiff-T2A-mCherry
UseAAVPromoter11xUAS with TATA-box minimal promoterAvailable sinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Omega Destination-CMV::ELuc:bGH
Plasmid#124528PurposeOmega destination vector, that has a CMV:ELUC:bgH in the backboneDepositorTypeEmpty backboneUseLuciferase and Synthetic BiologyExpressionMammalianAvailable sinceJune 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.0_LynLAMA-G97 IRES EGFP
Plasmid#130711PurposePlasmid encoding outer inner membrane localization of LAMA-G97 for GFP as a SNAP-Tag-fusion and EGFPDepositorInsertLyn11-SNAP-Tag-LAMA-G97 IRES EGFP
TagsLyn11 and SNAP-TagExpressionMammalianAvailable sinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.0_mitoLAMA-F98 IRES ShadowG-mScarlet
Plasmid#130708PurposePlasmid encoding outer mitochondrial localization of LAMA-F98 for GFP as a SNAP-Tag-fusion and ShadowG-mScarletDepositorInsertNTOM20-SNAP-Tag-LAMA-F98 IRES ShadowG-mScarlet
TagsNTOM20 and SNAP-TagExpressionMammalianAvailable sinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKAd5f11pABR-EPG
Plasmid#122699PurposeIt can be used to construct a recombinant virus carrying other transgene or an adenovector with modified fiber.DepositorInsertGFP
UseAdenoviralAvailable sinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZH514
Plasmid#102667PurposeConstitutive expression of GFPmut2; strong ribosome binding site; GFPmut2 ORF can be replaced with gene of interest by isothermal assemblyDepositorInsertGFPmut2
ExpressionBacterialAvailable sinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBN67
Plasmid#86714PurposeDamID control plasmid for C. elegansDepositorInsertPhsp16.41::GFP::MYCDam
ExpressionWormAvailable sinceFeb. 7, 2017AvailabilityAcademic Institutions and Nonprofits only