We narrowed to 8,980 results for: sgRNA
-
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_UPF3A/UPF3B (pAVA3129)
Plasmid#239329PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting UPF3A and UPF3BDepositorInsertU6-driven sgRNA1 targting UPF3A and 7SK-driven sgRNA2 targeting UPF3B (UPF3B Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP64 (pAVA3500)
Plasmid#239237PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP64DepositorInsertU6-driven sgRNA targeting RMP64
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP24 (pAVA3547)
Plasmid#239240PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP24DepositorInsertU6-driven sgRNA targeting RMP24
ExpressionMammalianAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP24 (pAVA3555)
Plasmid#239242PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP24DepositorInsertU6-driven sgRNA targeting RMP24
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP24 (pAVA3563)
Plasmid#239258PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP24DepositorInsertU6-driven sgRNA targeting RMP24
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP64 (pAVA3572)
Plasmid#239259PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP64DepositorInsertU6-driven sgRNA targeting RMP64
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs-RMRP (pAVA3583)
Plasmid#239260PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RMRPDepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RMRP
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs-RMRP (pAVA3584)
Plasmid#239261PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RMRPDepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RMRP
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs-RPPH1 (pAVA3585)
Plasmid#239262PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPPH1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPPH1
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo PTEN sgRNA5
Plasmid#233246PurposeKnock out of murine PTENDepositorInsertPTEN (Pten Mouse)
UseLentiviralAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo PTEN sgRNA2
Plasmid#233245PurposeKnock out of murine PTENDepositorInsertPTEN (Pten Mouse)
UseLentiviralAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_NbATML1-2pro and NbATML1-1pro
Plasmid#231155PurposeT-DNA encoding TRV2 with mobile gRNAs targeting NbATML1-2pro and NbATML1-1proDepositorInsertmobile gRNAs targeting NbATML1-2pro and NbATML1-1pro
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
LsgRNA-FXR1-KH1-gRNA
Plasmid#225483PurposeExpress gRNA for FXR1DepositorAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
mPLD3-sgRNA-Cas9-mcherry
Plasmid#199700Purposeencodes sgRNA for mouse PLD3 KO, (target 217-223aa) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterU6 promoterAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA scaffold-spacer-mouse U6
Plasmid#214698Purposeprovide "sgRNA scaffold-spacer-mouse U6" fragmentDepositorInsertsgRNA scaffold-spacer-mouse U6
UseCRISPRAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL661-WT(TTTT)
Plasmid#215864PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL661 with TTTT stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only