We narrowed to 9,048 results for: sgRNA
-
Plasmid#234497PurposeNEOR-CnU6-empty sgRNADepositorInsertNEO-PCnU6-sgRNA_scaffold
UseCRISPRExpressionBacterial and YeastAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBHM2619
Plasmid#234498PurposeamdS-CnU6-empty sgRNADepositorInsertamdS-PCnU6-sgRNA_scaffold
UseCRISPRExpressionBacterial and YeastAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJT303_SNR52_sgRNA_Can1-3
Plasmid#145066PurposeExpresses sgRNA targeting Can1-3 siteDepositorInsertCan1-3 sgRNA
UseCRISPRExpressionYeastPromoterSNR52Available SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWT060e
Plasmid#107905PurposeW2m.0-3, W2m.3-2 plasmid. Contains U6-sgRNA B (CCR5) and is part of the CAMERA2m system for cellular recording in mammalian cellsDepositorInsertU6-sgRNA B (CCR5)
ExpressionMammalianAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
p183_LTJ_sgRNACD90.2_A
Plasmid#82671PurposesgRNA targeting murine CD90.2. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting CD90.2
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mClover3_AAVS1_sgRNA_2
Plasmid#155099Purposelentiviral plasmid expressing mClover3, Cas9 and a gRNA targeting the AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_AAVS1_sgRNA_2
Plasmid#155105Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting the AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP215.rAAV.mU6-sgRNA.Handle.EF1a-mTagBFP2
Plasmid#217635PurposeAAV backbone for sgRNA expression. Contains a Lox-flanked handle sequence for Cre-dependent PCR amplification of sgRNAs. Protospacer is cloned between BstXI and BlpI.DepositorInsertmU6-sgRNA, Handle sequence, EF1a-mTagBFP2
UseAAVPromoterEF1alpha and mU6Available SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3'UTR-ST2-com-vector
Plasmid#136269PurposeExpresses SpCas9 and sgRNA ScaffoldDepositorInsertSpCas9 and sgRNA scaffold
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgNeg2
Plasmid#166999PurposeLentiviral expression of negative control sgRNA for CRISPRi knockdownDepositorInsertNegative control sgRNA 2
UseCRISPR and LentiviralPromoterU6Available SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_DDX4-cterm
Plasmid#222520PurposeCas9/sgRNA plasmid for targeting DDX4DepositorInsertCas9, DDX4 sgRNA (DDX4 Human, Synthetic)
UseCRISPRAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJMP2367
Plasmid#160076PurposeZ. mobilis CRISPRi, promoter C, empty guide, sfGFPDepositorInsertempty sgRNA
ExpressionBacterialAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJMP2480
Plasmid#160080PurposeZ. mobilis CRISPRi, promoter C, empty guideDepositorInsertempty sgRNA
ExpressionBacterialAvailable SinceNov. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
MTK234_037
Plasmid#123912PurposeEncodes the spCas9 UAS (miniCMV core) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsgRNA-pUAS
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_041
Plasmid#123916PurposeEncodes the spCas9 mScarlet gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertmScarlet sgRNA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pC0.122
Plasmid#119629PurposeLevel 0 Part. CDSDepositorInsertsgRNA scaffold
UseSynthetic BiologyAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_LP1B_St1Cas9_LMD-9_SpA_U6_sgRNA
Plasmid#110624PurposeA single vector AAV-Cas9 system containing a liver-specific promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNADepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
UseAAV, CRISPR, and Mouse TargetingTagsSV40 NLSExpressionMammalianPromoterLP1B and hU6Available SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_LacZ_sgRNA
Plasmid#74179Purposelentiviral vector expressing sgRNA targeting LacZDepositorInsertLacZ sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 T922I
Plasmid#139328PurposePlasmid expressing a sgRNA to introduce BRCA1 T922I using base editingDepositorInsertsgRNA to insert BRCA1 T922I using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only