We narrowed to 22,628 results for: Ide

#87397

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87400

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#82569

High copy number plasmid containing PR2/3:Con MiniPromoter insert.

Elizabeth Simpson

Simpson et al Hum Gene Ther. 2018 Jul 31. doi: 10.1089

Sept. 14, 2016

Industry, Academic Institutions, and Nonprofits

#74917

Mammalian expression of rNanog

Jose Silva

Theunissen et al Development. 2011 Nov;138(22):4853-65. d

May 17, 2016

Academic Institutions and Nonprofits only

#29041

Expression of the reporter gene under the control of the MiniPromoter in this plasmid has not been tested

Elizabeth Simpson

Portales-Casamar et al Proc Natl Acad Sci U S A. 2010 Sep 21. 1

Jan. 9, 2012

Academic Institutions and Nonprofits only

#29060

Expression of the eGFP reporter gene was not detected in the brain and eye.

Elizabeth Simpson

Portales-Casamar et al Proc Natl Acad Sci U S A. 2010 Sep 21. 1

Jan. 6, 2012

Academic Institutions and Nonprofits only

#29059

Pleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNAS, 2010 (PMID: 20807748).

Elizabeth Simpson

Portales-Casamar et al Proc Natl Acad Sci U S A. 2010 Sep 21. 1

Nov. 16, 2011

Academic Institutions and Nonprofits only

#29138

Expression of the reporter gene under the control of the MiniPromoter in this plasmid has not been tested

Elizabeth Simpson

Portales-Casamar et al Proc Natl Acad Sci U S A. 2010 Sep 21. 1

Nov. 4, 2011

Academic Institutions and Nonprofits only

#29253

Pleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNAS, 2010 (PMID: 20807748).

Elizabeth Simpson

Portales-Casamar et al Proc Natl Acad Sci U S A. 2010 Sep 21. 1

Oct. 21, 2011

Industry, Academic Institutions, and Nonprofits

#29254

Pleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNAS, 2010 (PMID: 20807748).

Elizabeth Simpson

Portales-Casamar et al Proc Natl Acad Sci U S A. 2010 Sep 21. 1

Oct. 21, 2011

Industry, Academic Institutions, and Nonprofits

#249069

Expresses nucleus-localized nCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.

John Dueber, David Schaffer

Hurtado et al Nat Commun. 2025 Apr 19;16(1):3723. doi:

Jan. 7, 2026

Academic Institutions and Nonprofits only

#247871

Mammalian expression construct for C-terminal S protein-Flag-Streptavidin binding peptide (SFB)-tagged SLX4IP

Junjie Chen, Huimin Zhang

Zhang et al Nucleic Acids Res. 2019 Nov 4;47(19):101

Dec. 12, 2025

Academic Institutions and Nonprofits only

#238880

Express JAK1-NanoLuc Fusion Protein in Mammalian Cells under a CMV promoter

Promega Corporation

Sept. 16, 2025

Industry, Academic Institutions, and Nonprofits