We narrowed to 14,474 results for: cas9 genes
-
Plasmid#232209PurposeEndogenous tagging of genes by CRISPR/Cas9-mediated homologous recombination; for C-terminal tagging: 3xTy-T2A-BSD-3xTyDepositorInsert3xTy
ExpressionBacterialAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRExT2A-NT-PTy
Plasmid#232202PurposeEndogenous tagging of genes by CRISPR/Cas9-mediated homologous recombination; for N-terminal tagging: PAC-3xTy-T2A-3xTyDepositorInsert3xTy
ExpressionBacterialAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRExT2A-NT-PmSc
Plasmid#232548PurposeEndogenous tagging of genes by CRISPR/Cas9-mediated homologous recombination; for N-terminal tagging: PAC-3xTy-T2A-3xTy-mScarletDepositorInsertmScarlet
ExpressionBacterialMutationNoneAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pG3H-PE3max-attR1R2
Plasmid#213049PurposeDestination vector Expressing nCas9 and RT fusion protein and carrying Gateway recombination sitesDepositorInsertsCas9 nickase
M-MLV Reverse Transcriptase
UseNote: this plasmid needs helper pvs1-vir2 for rep…ExpressionPlantMutationH840A, R240K, N413K,Available SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgPBRM1-1- LentiCRISPRv2
Plasmid#107403PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgPBRM1-2- LentiCRISPRv2
Plasmid#107404PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgHK2_2
Plasmid#163461Purposelentiviral vector expressing Cas9 and an sgRNA targeting HK2DepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLY152
Plasmid#130950Purposedcas9 generator and reporter circuit (PpspA-2G6 with sfgfp::ASV)DepositorInsertsdcas9
tetR
sfgfp
UseSynthetic BiologyTagsASV tagExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterPpspA-2G6 and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
gRNA giantin/GOLGB1
Plasmid#222315PurposeCRISPR/Cas9 close to the ATG of giantin/GOLGB1 gene.DepositorInsertgRNA targeting GOLB1 (GOLGB1 Human)
UseCRISPRAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUt-mNF-Cas13d
Plasmid#224789PurposeLPUtopia matching RMCE donor plasmid with mCherry-P2A-RfxCas13d Negative-Feedback circuit. Use BlastR for positive selection and HSV-TK for negative selection.DepositorInsertmCherry-P2A-RfxCas13d
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMV-d2iAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTij_sg_mmu_Med6_C_terminal
Plasmid#197869PurposeCRISPR/Cas9/sgRNA plasmid for cutting Med6 C terminal and building MED6-mEmerald/Halo knock-in mESCsDepositorAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRCT
Plasmid#60621PurposePlasmid encoding iCas9, tracrRNA and crRNAsDepositorInsertsiCas9
tracrRNA
UseCRISPRTagsFLAG and SV40 NLSExpressionYeastMutationchanged Aspartate 147 to Tyrosine, Proline 411 to…PromoterRPR1p and TEF1pAvailable SinceOct. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEGF-exon1
Plasmid#177261PurposeA knockout vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEGF-5’UTR
Plasmid#177260PurposeA knockout vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dNrg1
Plasmid#173696PurposeA knockout vector for the dog Nrg1.DepositorInsertA gRNA targeting the dog Nrg1 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEreg
Plasmid#173697PurposeA knockout vector for the dog Ereg.DepositorInsertA gRNA targeting the dog Ereg gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTgfa
Plasmid#173698PurposeA knockout vector for the dog Tgfa.DepositorInsertA gRNA targeting the dog Tgfa gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only