We narrowed to 14,178 results for: cas9
-
Plasmid#104048PurposeEncodes gRNA for 3' target of human NFIA_iso1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only
-
PX458_RXRB_1
Plasmid#104050PurposeEncodes gRNA for 3' target of human RXRB along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
SOX17-3'gRNA
Plasmid#210465PurposegRNA targeting SOX17 3' terminal for CRISPR-Cas9-mediated knock-inDepositorInsertSOX17 (SOX17 Human)
UseCRISPRAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-KLF7-1
Plasmid#169797PurposeExpresses Cas9 and guide RNA for the site neighbouring KLF7 gene.DepositorInsertguide RNA for KLF7 neighbouring region
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR sgSHMT2_1
Plasmid#106308PurposeExpress Cas9 and sgRNA targeting SHMT2DepositorInsertsgRNA targeting SHMT2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEn-C1.1
Plasmid#61479PurposeEncodes CRISPR sgRNA for Gateway or conventional cloning of 1-3 sgRNAs into pDe-CAS9 or pCAS9-TPCDepositorInsertAtU6-26:sgRNA
UseCRISPRExpressionPlantPromoterU6-26Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR sgSHMT1_1
Plasmid#106311PurposeExpress Cas9 and sgRNA targeting SHMT1DepositorInsertsgRNA targeting SHMT1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgSHOC2-2
Plasmid#86129PurposeLentiviral vector expressing Cas9 and an sgRNA targeting SHOC2DepositorAvailable SinceMay 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgPREX1
Plasmid#86127PurposeLentiviral vector expressing Cas9 and an sgRNA targeting PREX1DepositorAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pODN-mR2-ACTB
Plasmid#183868PurposeRepair template for the N-terminal tagging of beta-actin with mRuby2 in human cells using CRISPR/Cas9.DepositorInsertACTB homology arms with mRuby2-linker (ACTB Human)
UseCRISPR; Donor templateTagsmRuby2-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF2
Plasmid#106102PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF2DepositorInsertgRNA targeting CELF2 (CELF2 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIAL1
Plasmid#106096PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIAL1DepositorInsertgRNA TIAL1
UseCRISPRAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_RB1#1
Plasmid#174150PurposeLentiviral vector expressing Cas9 and a sgRNA against the human RB1 geneDepositorInsertRB1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSG1016-2xBsaI-SaKKH_P2A_EGFP
Plasmid#239461PurposeCodon-optimized S. aureus KKH Cas9. 2x BsaI sites for easy cloning of varying deaminases. EGFP can serve as a transfection marker.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianPromoterCMVAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-ACTB-C4
Plasmid#229849PurposeExpresses wild-type Cas9 and gRNA for ACTB gene. The target sequence is changed from ACTB-C1 to improve the cut efficiency.DepositorInsertguide RNA for ACTB gene
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.8m-SpG-P2A-EGFP (BKS965)
Plasmid#242652PurposeCMV promoter expression plasmid for human codon optimized ABE8.8m A-to-G base editor with SpG(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.8m-SpG-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.8 mutations in TadA, SpG mutations in SpCas9…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
Chr1q_Centromere-Targeting_gRNA
Plasmid#195125PurposegRNA targeting centromere-proximal location on Chromosome 1q in a third generation Cas9 backbone with GFPDepositorInsertChr1q gRNA
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Cre stuffer v4
Plasmid#158032Purposelenti-viral construct with Cre recombinase and U6 driven sgRNA casette with modified tracrRNA (20bp sgRNA can be cloned by digesting the stuffer 1.8kb with BsmBI). NO Cas9DepositorTypeEmpty backboneExpressionMammalianAvailable SinceSept. 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti-Puro-sgNUAK1
Plasmid#138692PurposeExpresses a human NUAK1-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only