We narrowed to 11,595 results for: Emb;
-
Plasmid#180354Purposemammalian co-expression of human SEPT7 Gmut1 fused to GFP10 and of human SEPT7 Gmut1 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT7 W269A, H279DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pTRIP TRE BI_GFP11-14-SEPT7 Gmut1_SEPT9_i1 Gmut-14-GFP10
Plasmid#180355Purposemammalian co-expression of human SEPT9_i1 Gmut fused to GFP10 and of human SEPT7 Gmut1 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT7 W269A, H279D and SEPT9_i1 W520A, H530DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_GFP11-14-SEPT7 Gmut1_SEPT9_i3 Gmut-14-GFP10
Plasmid#180356Purposemammalian co-expression of human SEPT9_i3 Gmut fused to GFP10 and of human SEPT7 Gmut1 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT7 W269A, H279D and SEPT9_i3 W502A, H512DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_SEPT9_i3 NCmut-14-GFP11_SEPT9_i3 NCmut-14-GFP10
Plasmid#180360Purposemammalian co-expression of human SEPT9_i3 NCmut fused to GFP10 and of human SEPT9_i3 NCmut fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT9_i3 I263D, M270DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GST-hFIP200(Delta641-779, 1363-1370Mut)-MBP
Plasmid#190039PurposeExpression of FIP200 mutantDepositorInsertFIP200 (RB1CC1 Human)
TagsGST and MBPExpressionMammalianMutation(641-779)deletion & 1363 RDKDLIES 1370 to GSS…PromoterCMVAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATX3 13Q- I77K Q78K W87K
Plasmid#185908PurposeExpresses ataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track-I77K, Q78K,W87K (N-terminal ) fused with His-Tag and TEV cleavage sequence (C-terminal).DepositorInsertataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track and point mutations I77K, Q78K and W87K (ATXN3 Synthetic, Human)
Tags6x His-Tag and TEV cleavage siteExpressionBacterialMutationPoint mutations in Atx3 gene I77K Q78K and W87KAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHsSyx3-MBP
Plasmid#179286PurposeE. coli expression plasmid (T7 promoter) for expression-optimized DNA of human Syx (aa 393-792) with C-terminal TEV protease cleavage site + mature maltose binding protein + His6DepositorInsertSyx
TagsTEV protease cleavage site + mature maltose bindi…ExpressionBacterialMutationresidues 393-792 from accession number NP_0010361…PromoterT7Available SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMBP-HsSyx3
Plasmid#179287PurposeE. coli expression plasmid (T7 promoter) for expression-optimized DNA of human Syx (aa 393-792) with N-terminal His6 + mature maltose binding protein + TEV protease cleavage siteDepositorInsertSyx
TagsHis6 + mature maltose binding protein + TEV prote…ExpressionBacterialMutationresidues 393-792 from accession number NP_0010361…PromoterT7Available SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
CXCR4-SZ158a-sfGFP
Plasmid#162446PurposeExpression in HEK293T cell and compete ligand singaling against full-length receptorsDepositorInsertC-X-C chemokine receptor type 4 (CXCR4 Human)
TagssfGFPExpressionMammalianMutationtruncation from aa52 to aa257PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pLV-Iba1-mCherry-P2A-3xHA-TurboID-hCD9-4xmiR9T-4xmiR129-2-3pT
Plasmid#255758PurposeLentiviral microglia-specific expression vector of TurboID fused to human CD9 and mCherryDepositorInsertmCherry, CD9 (CD9 Synthetic, Human)
UseLentiviralTags3xHA-TurboIDExpressionMammalianPromoterIba1Available SinceJune 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
HisGB1-CITED2(216-270) + CBP TAZ1(340-439)
Plasmid#254287PurposeBacterial coexpression of human CITED2 CTAD with CBP TAZ1DepositorTags6X His-tagged GB1ExpressionBacterialPromoterT7Available SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSB-CMV-MCS-Puro ArfGAP1_ALPS1_ALPS2-mKate2-P2A-EGFP-LMNB1
Plasmid#250905PurposeDual color expression of mKate2 tagged human ARFGAP1 ALPS 1-2 and EGFP tagged zebrafish LaminB1 in mammallian cell linesDepositorTagsEGFP on LMNB1 and mKate2 on ArfGAP1ExpressionMammalianMutationARFGAP1 amino acids 192–304 onlyPromoterCMVAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSB-CMV-MCS-Puro-ArfGAP1_ALPS1-mKate2-3NLS-P2A-eGFP-LMNB1
Plasmid#250914PurposeDual color expression of mKate2-3xNLS tagged rat ALPS1 and eGFP tagged zebrafish Lamin B1 in mammalian cell linesDepositorTagsEGFP on LMNB1 and mKate2 on ArfGAP1ExpressionMammalianMutationARFGAP1 amino acids 196–234 onlyPromoterCMVAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-mouse cGASdeltaN-GFP
Plasmid#186878PurposeDoxycycline-dependent expression of mouse cGAS gene in mammalian cells by retroviral transductionDepositorInsertMouse cGAS truncation mutant (148-508 a.a.) with C-terminal GFP fusion (Cgas Mouse, Synthetic)
UseRetroviralTagsGFPMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBP-HsSyx-375-792
Plasmid#179291PurposeE. coli expression plasmid (T7 promoter) for expression-optimized DNA of human Syx (aa 375-792) with N-terminal His6 + mature maltose binding protein + TEV protease cleavage siteDepositorInsertSyx
TagsHis6 + mature maltose binding protein + TEV prote…ExpressionBacterialMutationresidues 375-792 from accession number NP_0010361…PromoterT7Available SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C I730C (NT809)
Plasmid#50866PurposeExpresses human NKCC1 P676C I730C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationP676C I730C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only