We narrowed to 62,038 results for: SAP
-
Plasmid#82298PurposeGateway Donor vector containing MAPK14, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
PSD-95 scFv [K28/43]
Plasmid#190489PurposeMammalian Expression of PSD-95 scFV. Derived from hybridoma K28/43.DepositorInsertPSD-95 (Homo sapiens) recombinant scFV (DLG4 Mouse)
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
PSD-95 scFv [K28/38]
Plasmid#190487PurposeMammalian Expression of PSD-95 scFV. Derived from hybridoma K28/38.DepositorInsertPSD-95 (Homo sapiens) recombinant scFV (DLG4 Mouse)
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLX307/PTPN11 T73I
Plasmid#140939Purposeexpresses PTPN11 T73IDepositorInsertPTPN11 protein tyrosine phosphatase non-receptor type 11 [ Homo sapiens (human) ] (PTPN11 Human)
TagsV5ExpressionMammalianMutationT73IPromoterEF1aAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX307/PTPN11 E76G
Plasmid#140862Purposeexpresses PTPN11 E76GDepositorInsertPTPN11 protein tyrosine phosphatase non-receptor type 11 [ Homo sapiens (human) ] (PTPN11 Human)
ExpressionMammalianMutationE76GPromoterEF1aAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHLsec hSOD1
Plasmid#232481Purposevector for transient transfection expressing human SOD1gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
TagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCAGAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
OMM-short-RspA-CFAST
Plasmid#233594PurposeExpression of RspA-CFAST on the outer mitochondrial membraneDepositorInsertTOM70 fragment-RspA-CFAST (TOMM70 RspA-CFAST from Rheinheimera sp A13L and TOM70 fragment from Homo sapiens, Human)
ExpressionMammalianPromoterCMVAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 FFSS-BACH1 C122E
Plasmid#232274PurposeExpression of N-terminal tagged 2xFLAG-2xSTREP-BACH1 (H. sapiens) with Cys122 to Glu point mutation in human cell linesDepositorInsertBACH1 (BACH1 Human)
Tags2xFLAG-2xSTREPExpressionMammalianMutationchanged cysteine 122 to glutamic acidPromoterCMVAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(RUNX1(13))-hU6gRNA5(RUNX3(12))-PGKpuroBFP-W
Plasmid#208569PurposeLentiviral vector expressing gRNA targeting human RUNX1 and RUNX3DepositorAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(RUNX1(13))-hU6gRNA5(RUNX3(13))-PGKpuroBFP-W
Plasmid#208570PurposeLentiviral vector expressing gRNA targeting human RUNX1 and RUNX3DepositorAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(AAVS1)-PGKpuroBFP-W
Plasmid#200506PurposeLentiviral vector expressing gRNA targeting human ARID1A and AAVS1DepositorAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_MSH6_FBXO11
Plasmid#205859PurposeExpress mEGFP-tagged fusion protein, MSH6_FBXO11 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_JARID2_SYNCRIP
Plasmid#205834PurposeExpress mEGFP-tagged fusion protein, JARID2_SYNCRIP from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-POLBHR-eGFP
Plasmid#176064PurposeHomology region +/- 800bp to the transcription start site of POLB, with EGFP inserted in-frame on the N-terminus of POLB, and a mutation in the PAM site used by POLBKO gRNA1 in POLB exon1DepositorInsertEGFP-PolB (POLB Human)
TagsEGFPExpressionMammalianMutationpUC with endogenous SapI mutated out, PAM mutatio…PromoterN/AAvailable SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB-CuR-hSOD1
Plasmid#232477PurposeThe inducible PiggyBac Cumate Switch vector (PBQM812A-1 System Biosciences) expressing human SOD1gene including flag -tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-CuOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-EGFP (ANV)
Plasmid#71685PurposeExpression of mutant human codon-optimized dCas9-DNMT3A fusion (inactive catalytic domain of DNMT3A) with T2A-EGFP; cloning backbone for sgRNADepositorInsertS. pyogenes dCas9 fused with the inactivated (E756A) catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-EGFP (DNMT3A S. pyogenes, Synthetic, Human)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-EGFPExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E756A inactiva…PromoterCBhAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 hMOG-beta1-EGFP
Plasmid#160978PurposeExpresses a human myelin oligodendrocyte glycoprotein isoform beta1 - EGFP fusion protein in mammalian cellsDepositorInsertHomo sapiens myelin oligodendrocyte glycoprotein (MOG), transcript variant beta1 (MOG Human)
TagsEGFPExpressionMammalianAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR (ANV)
Plasmid#71684PurposeExpression of mutant human codon-optimized dCas9-DNMT3A fusion (inactive catalytic domain of DNMT3A) with T2A-PuroR; cloning backbone for sgRNADepositorInsertS. pyogenes dCas9 fused with the inactivated (E756A) catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-PuroR (DNMT3A S. pyogenes, Synthetic, Human)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E756A inactiva…PromoterCBhAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only