We narrowed to 1,992 results for: cp
-
Plasmid#185448PurposeCoexpresses human POT1 with a zz affinity tag, YBBR site, and TEV site, human TRF2 with a zz tag and TEV site, and human TIN2 and TPP1 each with an MBP affinity tag and TEV site in insect cellsDepositorTagsMBP, YBBR, and ZZExpressionInsectMutationSee Depositor Comments BelowAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pSinREP5-iAchSnFR
Plasmid#140643PurposeAcetylcholine sensor for sindbis virusDepositorArticleInsertAch sensor V9
ExpressionMammalianPromoterSP6Available SinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDHa_mDDX5_FL_wt
Plasmid#88869Purposeconstitutive expression of Ha-DDX5 in mammalian cellsDepositorAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDHa_mDDX5_FL_K144N
Plasmid#88870Purposeconstitutive expression of Ha-DDX5 K144N in mammalian cellsDepositorAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYEE
Plasmid#159750PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by YFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mEGFPe-IFNAR1(28-557)
Plasmid#187844PurposeExpression of SNAPf and mEGFPe-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and meGFPe…ExpressionMammalianMutationmeGFPe: asparagine 198 to aspartic acid and tyros…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn syph-GFP-myc-BoNT/B(1-146)-iLID
Plasmid#122981PurposeAAV plasmid with human synapsin promoter driving synaptophysin fused to GFP, iLID(V416I) and BoNT/B amino acids 1-146. Co-express with SSPB-BoNT(147-441, Y365A) for vPA-BoNTDepositorInsertSyph-GFP-myc-BoNT/B(1-146)-iLID (Syp Synthetic, Rat)
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsinAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mXFPe-IFNAR1(28-557)
Plasmid#192785PurposeExpression of SNAPf and mXFPe-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and mXFPeExpressionMammalianMutationmXFPe: tyrosine 66 to phenylalanine, asparagine 1…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTEE
Plasmid#159748PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by mTomato fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
TMEM138-mCherry
Plasmid#41630DepositorAvailable SinceApril 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCEE
Plasmid#159746PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by CFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA TMEM 138-flag
Plasmid#41628DepositorAvailable SinceApril 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
HEK4-53bp-tag-insertion-pegRNA
Plasmid#227673PurposePegRNA for 53 bp insertionDepositorAvailable SinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mEGFPm-IFNAR1(28-557)
Plasmid#192704PurposeExpression of SNAPf and mEGFPm-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and meGFPm…ExpressionMammalianMutationmeGFPm: gluatmic acid 142 to asparagine and histi…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mXFPm-IFNAR1(28-557)
Plasmid#192784PurposeExpression of SNAPf and mXFPm-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and mXFPmExpressionMammalianMutationmXFPm: tryptophan 66 to phenylalanine, gluatmic a…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
PP-ChK
Plasmid#25307PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceDec. 21, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV.CAG.iAChSnFR
Plasmid#137955PurposeExpresses iAChSnFR under CAG promoterDepositorArticleHas ServiceAAV1InsertiAChSnFR
UseAAVExpressionMammalianPromoterCAGAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
132_pAAV-ProB2-CatCh-GFP-WPRE
Plasmid#125922PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB2Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.iAChSnFR
Plasmid#137950PurposeExpresses iAChSnFR under hSynapsin promoterDepositorArticleHas ServiceAAV1InsertiAChSnFR
UseAAVExpressionMammalianPromoterhSynanpsinAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only