We narrowed to 24,186 results for: CRISPR
-
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
mPLD3-sgRNA-Cas9-mcherry
Plasmid#199700Purposeencodes sgRNA for mouse PLD3 KO, (target 217-223aa) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterU6 promoterAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK2-J11
Plasmid#218224PurposeTerminates AtU6-promoter driven sgRNA array with two guides, MoClo CompatibleDepositorInsertlinker sequence
UseCRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK2-K3
Plasmid#218221PurposeFuses Guides 1+2 to guides 3+4 in an of AtU6-promter driven sgRNAsDepositorInsertlinker sequence
UseCRISPRAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK4-J11
Plasmid#218225PurposeTerminates AtU6-promoter driven sgRNA array with four guides, MoClo CompatibleDepositorInsertlinker sequence
UseCRISPRAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK6-J11
Plasmid#218226PurposeTerminates AtU6-promoter driven sgRNA array with tsix guides, MoClo CompatibleDepositorInsertlinker sequence
UseCRISPRAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK4-K5
Plasmid#218222PurposeFuses Guides 3+4 to guides 6+6 in an of AtU6-promter driven sgRNAsDepositorInsertlinker sequence
UseCRISPRAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK8-J11
Plasmid#218227PurposeTerminates AtU6-promoter driven sgRNA array with eight guides, MoClo CompatibleDepositorInsertlinker sequence
UseCRISPRAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK6-K7
Plasmid#218223PurposeFuses Guides 5+6 to guides 7+8 in an of AtU6-promter driven sgRNAsDepositorInsertlinker sequence
UseCRISPRAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKSB- PUb-NLSmTurqSV40 GGGG AAGA
Plasmid#174535PurposePUb-mTurquoise fluorescence marker cassette for gene knock-in in mosquitoesDepositorInsertPUb-mTurquoise BsaI cassette
ExpressionInsectPromoterAedes aegypti PolyubiquitinAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSB- PUb-DsRedSV40 GGGG AAGA
Plasmid#174538PurposePUb-DsRed fluorescence marker cassette for gene knock-in in mosquitoesDepositorInsertPUb-DsRed BsaI cassette
ExpressionInsectPromoterAedes aegypti PolyubiquitinAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
T7m
Plasmid#121030PurposeMoClo golden gate assembly DE part for tracrRNA terminator (natural terminator from S. pyogenes CRISPR-system tracrRNA). Please see Supplemental Documents for annotated Genbank file.DepositorInsertS. pyogenes tracrRNA terminator
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
C41m
Plasmid#120974PurposeMoClo golden gate assembly CD part for dCas9 (Catalytically-inactive S. pyogenes Cas9, for gRNA-targeted repression). Please see Supplemental Documents for annotated Genbank file.DepositorInsertdCas9
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-zwf
Plasmid#65825Purposezwf targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertzwf guide
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induc…Available SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-udhA
Plasmid#65818PurposeudhA targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertudhA guide
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induc…Available SinceAug. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA2
Plasmid#65817PurposegltA targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertgltA2 guide
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induc…Available SinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHRdSV40-dCas9-10xGCN4_v4-P2A-BFP
Plasmid#60903PurposeExpressed a nuclease dead Cas9 tagged with 10 copies of the GCN4 peptide v4 and BFP. This plasmid is part of the SunTag system for gene activationDepositorInsertCas9 dead
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1869-1 pHR: U6-SpsgSV40 CMV-mCherry
Plasmid#84249PurposeExpresses Sp sgSV40 gRNA with a mCherry fluorescent markerDepositorInsertSp sgSV40
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
PEmax-mRNA
Plasmid#204472Purposeplasmid for PEmax mRNA IVTDepositorInsertPrime editor
UseCRISPRTagsnoExpressionMammalianPromoterT7Available SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2806-2 pHR: U6-Sasgv2TRE3G CMV-mCherry
Plasmid#84250PurposeExpresses optimized Sa sgTRE3G gRNA with a mCherry fluorescent markerDepositorInsertSa sgTRE3G
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only