We narrowed to 16,393 results for: grna
-
Plasmid#14764DepositorAvailable SinceApril 5, 2007AvailabilityAcademic Institutions and Nonprofits only
-
Intron-Tagging-pX330-Cas9-mCherry
Plasmid#159742PurposeExpresses Cas9-2A-mCherry and a sgRNA excising EGFP flanked by a splice acceptor and a splice donor from the Intron-Tagging-EGFP-Donor plasmid.DepositorInsertdonor plasmid targeting sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_PARP1
Plasmid#183312PurposeAll-in-One CRISPRko system with a guide RNA that targets PARP1 geneDepositorInsertPARP1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSUPER IKKalpha
Plasmid#26208DepositorInsertpSUPER IKK alpha (CHUK Human)
UseRNAiAvailable SinceAug. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSUPERIORpuro-shGAS5
Plasmid#46370DepositorAvailable SinceAug. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRS-puro shNEDD4L #2
Plasmid#27017DepositorAvailable SinceDec. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_DNMT3B
Plasmid#183284PurposeAll-in-One CRISPRko system with a guide RNA that targets DNMT3B geneDepositorInsertDNMT3B
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_DNMT3A
Plasmid#183283PurposeAll-in-One CRISPRko system with a guide RNA that targets DNMT3A geneDepositorInsertDNMT3A
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-3'UTR
Plasmid#136055PurposeCAPRIN1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCACGTTAGTGTCACAAATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-MORC2 ts1
Plasmid#115886PurposeMORC2 knockdownDepositorAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
shNTC
Plasmid#73549PurposeNon-targeting control shRNA cloned in retroviral vector pMLP (MSCV-based vector expressing shRNA in a mir30 context).DepositorInsertshNTC
UseRetroviralExpressionMammalianPromoterLTRAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFIV-H1-Puro-hPolß
Plasmid#18663DepositorInsertshRNA specific to human DNA polymerase beta (POLB Human)
UseLentiviral and RNAiExpressionMammalianMutationnoneAvailable SinceOct. 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_IDH1
Plasmid#183300PurposeAll-in-One CRISPRko system with a guide RNA that targets IDH1 geneDepositorInsertIDH1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
SL2-sgTelo-MTSa/BFP/pdCas9-C1
Plasmid#162760PurposeExpressing dCas9 and sgRNA containg MTSa targeting telomeresDepositorInsertdCas9 and sgRNA(SL2-sgTelo-MTSa)
ExpressionMammalianMutationdCas9(nuclease deactivated Cas9)PromoterU6/CMVAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAT15415-BEAR-GFP-target-mCherry
Plasmid#162995Purposeplasmid expressing an sgRNA targeting the BEAR-GFP plasmid along with an mCherry markerDepositorInsertsgRNA targeting the BEAR-GFP plasmid
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_IDH2
Plasmid#183301PurposeAll-in-One CRISPRko system with a guide RNA that targets IDH2 geneDepositorInsertIDH2
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-Neo-FF3
Plasmid#11665Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a CMV promoter controlling expression of Neomycin and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsNeoExpressionMammalianAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shTGFBR3 puro
Plasmid#58696PurposeLentiviral shRNA vector for knockdown of human TGFBR3DepositorAvailable SinceAug. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSicoR human Dicer3
Plasmid#14765DepositorAvailable SinceApril 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133C2.0
Plasmid#99893PurposeGolden Gate entry vector to express the 3rd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU6Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only