We narrowed to 823 results for: Anti-CRISPR
-
Plasmid#216394Purposedual-enSERT-2.2 vector for site-specific integration of.a two-color enhancer-reporter construct (human beta-globin promoter) into the H11 locus (separated by a synthetic insulator)DepositorTypeEmpty backboneUseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterHuman beta-globinAvailable sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pSMART Tmem192-3X HA (targeting vector for genomic tagging)
Plasmid#175777PurposepSMART Tmem192-3X HA (targeting vector for genomic tagging)DepositorInsertTMEM192 (TMEM192 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceFeb. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRb1/Cre
Plasmid#89647PurposeExpresses an Rb1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Rb1 (Rb1 Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NS3-NLS/VPR
Plasmid#112244PurposeEncodes the drug-preservable Cas9-NS3-NLS/VPR, which can be used to activate gene expression when combined with an NS3 inhibitor and appropriately designed sgRNA.DepositorInsertdCas9-NS3-NLS/VPR
UseTagsAU1 (N term on NS3) and HA (C term on NS3)ExpressionMammalianMutationNS3 mutant T54APromoterCMVAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgApc/Cre
Plasmid#89641PurposeExpresses an Apc-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Apc (Apc Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDY118A
Plasmid#182958PurposepSC101 ori, chl34 resistant. Cas9 induced at 0.4 μg/ml anhydrotetracycline, recombineering proteins induced by a 15 min heat-shock at 42°C, I-Scel (induced by 0.1 mM IPTG) is to cleave the pDonor2.DepositorInsertsCas9
Gam, Beta, Exo
I-scel
UseTagsExpressionMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgArid1a/Cre
Plasmid#89642PurposeExpresses an Arid1a-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Arid1a (Arid1a Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgAtm/Cre
Plasmid#89643PurposeExpresses an Atm-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Atm (Atm Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
px552-sg-gria1-HT
Plasmid#187652PurposeContains HaloTag to be inserted into the NTD of Gria1 (via HITI), single guide RNA to target Cas9 to Gria1 under control of the U6 promoter, and miRFP670 under control of human synapsin promoter.DepositorInsertsHaloTag donor sequence
miRFP670
UseAAV and CRISPRTagsN/AExpressionMammalianMutationPromoterSynapsinAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only