We narrowed to 16,429 results for: grna
-
Plasmid#77278Purpose3rd generation lentiviral gRNA plasmid targeting human PKMYT1DepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pBluescriptSKII+ U6-sgRNA(F+E) empty
Plasmid#74707PurposeEncodes an sgRNA for spCas9 driven by hU6 promoter with a modified scaffold (Chen et al. Cell 2013) and BbsI sites that allow insertion of a spacer sequenceDepositorInsertU6 promoter driving sgRNA with Bbsi sites for insertion of spacer sequence
ExpressionMammalianAvailable SinceJuly 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEJS1099: Dual-sgRNA.Design 4
Plasmid#159537PurposeDelivery of dual sgRNA cassettes and Nme2Cas9 in a single AAV vectorDepositorInsertNme2Cas9 with two guide RNA cassettes
UseAAV, CRISPR, and Mouse TargetingTagsNLSExpressionMammalianPromoterU1aAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
MAP2K4 gRNA (BRDN0001145410)
Plasmid#76651Purpose3rd generation lentiviral gRNA plasmid targeting human MAP2K4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP2K4 gRNA (BRDN0001148854)
Plasmid#76652Purpose3rd generation lentiviral gRNA plasmid targeting human MAP2K4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEJS1089: mini-AAV.sgRNA.Nme2Cas9
Plasmid#159536PurposeDelivery of Nme2Cas9 and its sgRNA in a single AAV vector with overall packaging size of 4.4 KbDepositorInsertNme2Cas9 with single guide RNA cassette
UseAAV, CRISPR, and Mouse TargetingTagsNLSExpressionMammalianPromoterU1aAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
ERBB3 gRNA (BRDN0001147088)
Plasmid#77481Purpose3rd generation lentiviral gRNA plasmid targeting human ERBB3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA_PDS
Plasmid#46966PurposeExpresses an sgRNA targeting the PDS gene in Nicotiana benthamiana from the Arabidopsis U6 promoterDepositorInsertAtU6p::sgRNA_PDS
UseCRISPR; Plant expressionAvailable SinceAug. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
ERBB3 gRNA (BRDN0001147186)
Plasmid#77479Purpose3rd generation lentiviral gRNA plasmid targeting human ERBB3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ERBB3 gRNA (BRDN0001149441)
Plasmid#77480Purpose3rd generation lentiviral gRNA plasmid targeting human ERBB3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA1-gRNA_B
Plasmid#74375PurposegRNA_B to knockout human AMPK alpha 1 using Cas9nDepositorAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDY1513 AAVS1 sgRNA
Plasmid#234832PurposesgRNA for AAVS1 STITCHR insertionDepositorInsertAAVS1 sgRNA
UseCRISPRAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA1-gRNA_A
Plasmid#74374PurposegRNA_A to knockout human AMPK alpha 1 using Cas9nDepositorAvailable SinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
CROP-sgRNA-MS2
Plasmid#153457PurposeCROP-seq vector with mCherry and x2 MS2 loops in gRNA scaffoldDepositorInsertsgRNA empty backbone
UseCRISPRExpressionMammalianAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBS U6a gRNA
Plasmid#158961PurposegRNA backbone driven by zebrafish U6a promoterDepositorInsertszf U6a promoter
gRNA backbone
UseCRISPRAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDY1622 NOLC1 sgRNA 1
Plasmid#234833PurposesgRNA 1 for NOLC1 STITCHR insertionDepositorInsertNOLC1 sgRNA (NOLC1 Human)
UseCRISPRAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSCAR_sgRNA_hygro-tagBFP-lox5171
Plasmid#162070Purpose3rd generation lentivirus sgRNA delivery backbone with Cre-removable tagBFP reporter and hygromycin resistanceDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:redCas9; control_gRNA
Plasmid#199334PurposepDEL157; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous control sgRNADepositorInsertszCREST3
Cas9
control sgRNA
UseTol2 destination vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
gRNA NIA TLS2
Plasmid#196981PurposeExpresses two gRNAs targeting Arabidopsis NIA1 gene for knockout. Each gRNA is fused to TLS2 mobility signal that confers graft mobility.DepositorInsertAtNIA1 gRNAs fused to TLS2 tags
ExpressionPlantPromoterpU6-26, pU6-29Available SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only