We narrowed to 16,319 results for: grna
-
Plasmid#234832PurposesgRNA for AAVS1 STITCHR insertionDepositorInsertAAVS1 sgRNA
UseCRISPRAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY1622 NOLC1 sgRNA 1
Plasmid#234833PurposesgRNA 1 for NOLC1 STITCHR insertionDepositorInsertNOLC1 sgRNA (NOLC1 Human)
UseCRISPRAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHelper-CRISPRi-sgRNA
Plasmid#221135PurposeHelper plasmid for sgRNA cloning for CRISPRi. sgRNA-scaffold with dCas9 handle expressed from constitutive bacterial promoter J23119(SpeI). 2 BbsI sites for sgRNA cloning.DepositorInsertsgRNA-scaffold with dCas9 handle
UseCRISPRExpressionBacterialPromoterJ23119(SpeI)Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCAR_sgRNA_hygro-tagBFP-lox5171
Plasmid#162070Purpose3rd generation lentivirus sgRNA delivery backbone with Cre-removable tagBFP reporter and hygromycin resistanceDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
BCKDK gRNA (BRDN0001147783)
Plasmid#75503Purpose3rd generation lentiviral gRNA plasmid targeting human BCKDKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
BCKDK gRNA (BRDN0001149253)
Plasmid#75505Purpose3rd generation lentiviral gRNA plasmid targeting human BCKDKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDY1623 NOLC1 sgRNA 2
Plasmid#234834PurposesgRNA 2 for NOLC1 STITCHR insertionDepositorInsertNOLC1 sgRNA (NOLC1 Human)
UseCRISPRAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA_PDS
Plasmid#46966PurposeExpresses an sgRNA targeting the PDS gene in Nicotiana benthamiana from the Arabidopsis U6 promoterDepositorInsertAtU6p::sgRNA_PDS
UseCRISPR; Plant expressionAvailable SinceAug. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSCAR_sgRNA_puro-mKate-lox5171
Plasmid#162077Purpose3rd generation lentivirus sgRNA delivery backbone with Cre-removable mKate2 reporter and puromycin resistanceDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
hNTo2-qgRNA-pYJA5
Plasmid#217782PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.spiezzo library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene ablation
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 2
Plasmid#51761PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 2
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
hNTo1-qgRNA-pYJA5
Plasmid#217781PurposeNon-targeting control 1 qgRNA-pYJA5 plasmid from the T.spiezzo library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene ablation
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROP-sgRNA-MS2
Plasmid#153457PurposeCROP-seq vector with mCherry and x2 MS2 loops in gRNA scaffoldDepositorInsertsgRNA empty backbone
UseCRISPRExpressionMammalianAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-AAVS1_B3903c_attP
Plasmid#182144PurposeTo insert attP attachment site at AAVS1 in human cells via twinPEDepositorInsertAAVS1_B3903c_attP pegRNA
ExpressionMammalianPromoterhU6Available SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-AAVS1_A3786c_attP
Plasmid#182143PurposeTo insert attP attachment site at AAVS1 in human cells via twinPEDepositorInsertA3786c-attP pegRNA
ExpressionMammalianPromoterhU6Available SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
EPHA7 gRNA (BRDN0001145253)
Plasmid#77351Purpose3rd generation lentiviral gRNA plasmid targeting human EPHA7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-CCR5_DF_B584b_attB
Plasmid#182148PurposeTo insert attB attachment site at CCR5 in human cells via twinPEDepositorInsertCCR5-B584b-attB pegRNA
ExpressionMammalianPromoterhU6Available SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-CCR5_DF_A509b_attB
Plasmid#182147PurposeTo insert attB attachment site at CCR5 in human cells via twinPEDepositorInsertCCR5-A509b-attB pegRNA
ExpressionMammalianPromoterhU6Available SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-SCR-sgRNA-A
Plasmid#177811PurposeOverexpression of sgRNAs in E. coli HT115 (scrambled targeting sequences)DepositorInsertScrambled sgRNA targeting sequences
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only