We narrowed to 1,181 results for: grna cloning vector
-
Plasmid#158236PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.AU1.FLAGExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.AU1.V5_NGFR
Plasmid#158237PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.AU1.V5ExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-BPTF-sh3
Plasmid#73667PurposepSIREN-RetroQ vector containing shRNA sequence to BPTFDepositorUseRetroviralTagsExpressionMutationPromoterAvailable sinceMarch 22, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMS73
Plasmid#110629PurposeCRISPR/Cas9 vector for mutliplexed genome editing in Ustilago maydis. Expresses U. maydis codon-optimized Cas9 under the hsp70 promoter, contains a short version of U6 promoter, is self-replicatingDepositorInsertsshort U6 promoter
cas9
tnos terminator
UseCRISPR; Self-replicating in ustilago maydis, conf…TagsN-terminal NLS, C-terminal HA-tag +NLSExpressionBacterialMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU. maydis hsp70 promoter (Kronstad and Leong, 198…Available sinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UC-Cas9-T2A-mCherry
Plasmid#135014PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to C-terminus of Cas9, linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
UseTags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the C-termi…PromoterCBhAvailable sinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UN-Cas9-T2A-mCherry
Plasmid#135013PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9, linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
UseTags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the N-termi…PromoterCBhAvailable sinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN527 - Rad21-AID[71-114]-eGFP-FRT-Blast-FRT targeting construct
Plasmid#156452PurposeTargeting vector to introduce an AID-eGFP cassette at the mouse RAD21 (SCC1) locus using BLASTICIDIN selection. Auxin-inducible degron system. Designed to be used with sgRNA CCACGGTTCCATATTATCTGDepositorInsertRAD21, AID (Rad21 Mouse)
UseMouse TargetingTagsExpressionMammalianMutationnonePromoterAvailable sinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN487 - Sororin-AID[71-114]-eGFP-FRT-Blast-FRT targeting conuct
Plasmid#156433PurposeTargeting vector to introduce an AID-eGFP cassette at the mouse Cdca5 (SORORIN) locus using BLASTICIDIN selection. Auxin-inducible degron system. Designed to be used with sgRNA GGGATGCCCGTCATTAAGTGDepositorInsertSORORIN, AID (Cdca5 Mouse)
UseMouse TargetingTagsExpressionMammalianMutationnonePromoterAvailable sinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTij_sg_mmu_Med6_C_terminal
Plasmid#197869PurposeCRISPR/Cas9/sgRNA plasmid for cutting Med6 C terminal and building MED6-mEmerald/Halo knock-in mESCsDepositorInsertMed6 (Med6 Mouse)
UseTagsExpressionMammalianMutationPromoterU6Available sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTij_sg_mmu_Med1_N_terminal
Plasmid#197870PurposeCRISPR/Cas9/sgRNA plasmid for cutting Med1 N terminal and building mEmerald/Halo-MED1 knock-in mESCsDepositorInsertCRSP210 (Med1 Mouse)
UseTagsExpressionMammalianMutationPromoterU6Available sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAU003 - pTRE3G-Cterm_Nterm_switch_CTCF-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE
Plasmid#156430PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingTagsExpressionMammalianMutationCterm_Nterm_switchedPromoterAvailable sinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN515 - pTRE3G-CTCF(ZFmut)-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE
Plasmid#156434PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA (all Zinc fingers point mutated), targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingTagsExpressionMammalianMutationAll zinc fingers mutatedPromoterAvailable sinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAU002 - pTRE3G-CTCF(DELTA1-265)-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE
Plasmid#156429PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingTagsExpressionMammalianMutationDELTA1-265PromoterAvailable sinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN366 - pTRE3G-CTCF-mRuby2-BGHpA-CAGGS-rtta3G-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt TIGRE donor
Plasmid#156432PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible wild-type CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingTagsExpressionMammalianMutationnonePromoterAvailable sinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAd-PR.Cre
Plasmid#192936PurposeAdenoviral expression vector encoding sgRNAs targeting Trp53 and Rb1 and CreDepositorUseAdenoviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAd-PR.CC9
Plasmid#192935PurposeAdenoviral expression vector encoding sgRNAs targeting Trp53 and Rb1, Cre and Cas9DepositorUseAdenoviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A_mmFbxw7(res) (closed)
Plasmid#160105PurposeExpresses murine Fbxw7 alpha with a T199 silent mutation in mammalian cells. The T199 silent mutation confers resistance to the 5'-TGAACATGGTACAAGGCCAG-3' sgRNADepositorInsertFbxw7alpha (Fbxw7 Mouse)
UseGateway entry vectorTagsExpressionMammalianMutationPromoterAvailable sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only