We narrowed to 25,353 results for: Spr
-
Plasmid#211962PurposeExpress gRNA against FOXH1 with puro and BFPDepositorInsertsgRNA targeting FOXH1 (FOXH1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(FOXH1_5-4)-PGKpuroBFP-W
Plasmid#211963PurposeExpress gRNA against FOXH1 with puro and BFPDepositorInsertsgRNA targeting FOXH1 (FOXH1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ID1_5-2)-PGKpuroBFP-W
Plasmid#211964PurposeExpress gRNA against ID1 with puro and BFPDepositorInsertsgRNA targeting ID1 (ID1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ID1_5-5)-PGKpuroBFP-W
Plasmid#211965PurposeExpress gRNA against ID1 with puro and BFPDepositorInsertsgRNA targeting ID1 (ID1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ETS2_5-2)-PGKpuroBFP-W
Plasmid#211958PurposeExpress gRNA against ETS2 with puro and BFPDepositorInsertsgRNA targeting ETS2 (ETS2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-MIR302-3g-EEA-2g-PGK-Puro
Plasmid#201677PurposeEBNA episome plasmid for U6 promoter-driven expression of 3 gRNAs targeting miRNA302/367 (Addgene #201960) and 2 gRNAs targeting EEA-motif (Addgene #102898). Includes PGK-puro selection cassetteDepositorInsertMIR302-3g-EEA-2g-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a-KRAB_crRNA Td2
Plasmid#176261PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged to the KRAB domain and Nlux and crRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 tRNA-gRNA E4-En-1 (GB2243)
Plasmid#160565PurposetRNA and scaffold for the assembly of GBoligomers for the position [4_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInserttRNA-gRNA position E4-En-1 (Multiplexing Edit)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gKAT6A-A8)-PGKpuro2ABFP-W
Plasmid#159290PurposeLentiviral vector expressing gRNA targeting KAT6A (gRNA ID. A8)DepositorInsertguide RNA targeting KAT6A (ID. A8) (KAT6A Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6 promoterAvailable SinceNov. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gKAT6A-A7)-PGKpuro2ABFP-W
Plasmid#159289PurposeLentiviral vector expressing gRNA targeting KAT6A (gRNA ID. A7)DepositorInsertguide RNA targeting KAT6A (ID. A7) (KAT6A Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6 promoterAvailable SinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCC_11 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-KRAB-dxCas9-NLS-2A-Puro-WPRE
Plasmid#139096PurposeExpresses human codon-optimized inactive xCas9 3.7 fused to a transcriptional repressor KRAB in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertKRAB-dxCas9 3.7
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840A, A262T, R324L,S409I, E480K, E543D, M6…Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP324-pAAV-FullH1TO-SaCa9sgRNAi(emx1sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113701PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113699PurposeDox-inducible U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKmCherry2ABFP-W
Plasmid#67985PurposeCas9 activity reporter (control) with mCherry and BFPDepositorInsertU6gRNA cassette, PGKmCherryABFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2AmCherry-W
Plasmid#67977PurposeCRISPR gRNA expression vector with an improved scaffold and puro/mCherry markersDepositorInsertU6gRNA cassette, PGKpuro2AmCherry cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDY0181 Cargo EGFP with AttP Bxb1 site (Parent minicircle)
Plasmid#179115PurposeCargo EGFP with AttP Bxb1 site (Parent minicircle)DepositorInsertCargo EGFP with AttP Bxb1 site
UseCRISPRAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDY0423 Cargo EGFP with AttP Bxb1 site for in-frame fusion (Parent minicircle)
Plasmid#179116PurposeCargo EGFP with AttP Bxb1 site for in-frame fusion (Parent minicircle)DepositorInsertCargo EGFP with AttP Bxb1 site for in-frame fusion
UseCRISPRAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYJA5
Plasmid#217778PurposeThe empty vector for quadruple sgRNA cloningDepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsPuromycin resistance gene, T2A, and TagBFPExpressionMammalianPromoterPGK, CMV, U6Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only