We narrowed to 11,984 results for: SOM
-
Plasmid#214422PurposeDetection of peroxisome-lipid droplet contact siteDepositorInsertPMP34-FKBP-V5-RspAN_IRES_CFAST-20nm-Halo-6xHp NC (SLC25A17 Human)
UseLentiviralTagsCFAST-Halo and FKBP-V5-RspANPromoterCMVAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ASAP4b-Kv-WPRE
Plasmid#201030PurposeExpresses somatically enriched ASAP4b in neurons, can be used to package AAVDepositorInsertASAP4b-Kv
UseAAVAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1a-FLEx-ASAP4b-Kv-WPRE
Plasmid#201032PurposeExpresses somatically enriched ASAP4b from the EF-1alpha promoter in a cre-dependent mannerDepositorInsertASAP4e-Kv
UseAAVAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-flex-Voltron-ST
Plasmid#119036PurposeCre-dependant expression of soma-localized Voltron in neuronsDepositorHas ServiceAAV1InsertVoltron-ST
UseAAV and Cre/LoxExpressionMammalianPromoterhsynAvailable SinceDec. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-PEX3
Plasmid#227304PurposeDonor template for mStayGold insertion into the C-terminus of the PEX3 locus. For peroxisome visualization. To be co-transfected with sgRNA plasmid px330-PITCh-PEX3 (Addgene #227303)DepositorInsertPEX3 Homology Arms flanking a mStayGold Tag (PEX3 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-RAB7A
Plasmid#227298PurposeDonor template for mStayGold insertion into the N-terminus of the RAB7A locus. For endosome visualization. To be co-transfected with sgRNA plasmid px330-RAB7A (Addgene #227297)DepositorInsertRAB7A Homology Arms flanking a mStayGold Tag (RAB7A Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR FL CPAP RNAi resistant
Plasmid#46390DepositorInsertCPAP RNAi resistant mutant (CENPJ Human)
UseEntry vectorMutationsilent mutation that renders it resistant to siRN…Available SinceJuly 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-EGFPC-uL10-(Neo)R
Plasmid#158069PurposeeGFP and uL10 ribosomal protein under the TRE3G promoter, Neo resistanceDepositorAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTH733-2µ-RLuc/maxCFLuc
Plasmid#40608DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pB80-SSPB(micro)-mVenus-GCN4-ppKin14VIb(861-1321)_P2A_iLID-mCherry-RAB11
Plasmid#174645PurposeOptogenetic coupling of RAB11 to tetramerized moss kinesin-14 to induce retrograde transport of recycling endosomesDepositorInsertSSPB(micro)-mVenus-GCN4-ppKin14VIb(861-1321)-P2A-ILID-mCherry-RAB11
TagsSSPB(micro)-Venus and iLID-mCherryExpressionMammalianMutationSSPB:Arg73Gln; mVenus: Met1Del, Thr154Met; ppKin1…PromoterChicken beta-actinAvailable SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTon1(il11)
Plasmid#233647PurposeExpression vector of X. laevis il11.L-P2A-AcGFP1 under control of tetracycline responsive element (TRE). Also express Tet-on advenced transactivator (rtTA) under control of minimal CMV promoter.DepositorInsertsinterleukin-11.L (350-913) (il11.L Frog)
target sequence of guide RNA #tyr (3905-3927) 5'-GGCTCCATGTCTTCCGTCCAAGG-3'
UseAmphibian expression, tet-onMutationSome synonymous substitutions were introduced in…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP Cep170 C-term (Nigg GG2)
Plasmid#41151DepositorInsertCep170 (CEP170 Human)
TagseGFPExpressionMammalianMutationContains C-terminal fragment (aa 755-1460, from X…PromoterCMV, T7Available SinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-VIM270-gSM
Plasmid#215870PurposeThis plasmid encodes luciferaase which has siRNA binding sites in 3'UTR for detecting the knockdown efficiency of siRNA.DepositorInsert3 tandem repeats of target site (complementary to seed seq of guide strand of siRNA for VIM) is inserted to 3'UTR of RLuc (VIM Human)
ExpressionMammalianAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-VIM270-gCM
Plasmid#215868PurposeThis plasmid encodes luciferaase which has siRNA binding sites in 3'UTR for detecting the knockdown efficiency of siRNA.DepositorInserttarget site which is completely complementary to guide strand of siRNA for vimentin is inserted to 3'UTR of RLuc (VIM Human)
ExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA NC
Plasmid#176259PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and spacer sequence on sgRNA is replaced by the type IIS restriction site for endonuclease BaeI andDepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Hyg-mEGFP-pp4640
Plasmid#191846PurposeExpresses Salmon Alphavirus polyprotein with mEGFP N-terminal fusionDepositorInsertmEGFP-pp4640
TagsmEGFPExpressionMammalianMutationmEGFP fusion in Nterminal, some silent point muta…PromoterCMVAvailable SinceNov. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
HOXB6 (human) FLAG pMSCV
Plasmid#8534DepositorInsertHOXB6 (HOXB6 Human)
UseRetroviralTagsFLAG and IRES-GFPExpressionMammalianMutationcontains improved ribosomal binding site and FLAG…Available SinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a_crRNA NC
Plasmid#176256PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged with Nlux and spacer sequence is replaced by the type IIS restriction site for endonuclease BaeI that can beDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only