We narrowed to 15,009 results for: GRN
-
-
-
Cdk12_intron3_sg2_pX330
Plasmid#127174PurposesgRNA that cuts within intron 3 of mouse Cdk12 genomic locus in pX330 backboneDepositorInsertMouse Cdk12 Intron 3 sgRNA
UseCRISPR and Mouse TargetingPromoterU6 PromoterAvailabilityAcademic Institutions and Nonprofits only -
Cdk12_intron4_sg1_pX458
Plasmid#127175PurposesgRNA that cuts within intron 4 of mouse CDK12 genomic locus in pX458 backboneDepositorInsertMouse Cdk12 Intron 4 sgRNA
UseCRISPR and Mouse TargetingPromoterU6 PromoterAvailabilityAcademic Institutions and Nonprofits only -
pTJK689 (EPOR KO in LentiCRISPRv2GFP)
Plasmid#254393PurposeExpress sgRNA targeting human EPORDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdGCas9_scr
Plasmid#207569PurposedGeoCas9-mediated silencing of genomic gene in E. coliDepositorInsertPlac/tet_dGeoCas9_PlacI_lacI_PJ23119_sgRNA(scrambled non-targeting spacer)
ExpressionBacterialMutationGeoCas9(D8A,H582A)Available SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX458 BLTP3A knockout
Plasmid#241256PurposeKnock-out plasmid targeting the second exon of human BLTP3A (UHRF1BP1)DepositorInsertBLTP3A (UHRF1BP1) KO gRNA (BLTP3A Human)
ExpressionMammalianAvailable SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGMF1-M
Plasmid#242203PurposeOsU6-2p::sgRNA scaffold in L1 vector backbone, for subcloning of 1st 20 bp target sequence. For use in monocots.DepositorInsertLevel1 OsU6-2p::sgRNA1 for subcloning of 20 bp target sequence
UseCRISPR and Synthetic BiologyExpressionPlantPromoterOsU6-2pAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGMF2-M
Plasmid#242204PurposeOsU6-2p::sgRNA scaffold in L1 vector backbone, for subcloning of 2nd 20 bp target sequence. For use in monocots.DepositorInsertLevel1 OsU6-2p::sgRNA2 for subcloning of 20 bp target sequence
UseCRISPR and Synthetic BiologyExpressionPlantPromoterOsU6-2pAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-E690_guide-CBh-hSpCas9
Plasmid#188545PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid E690DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-W308_guide-CBh-hSpCas9
Plasmid#188546PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid W308DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_DAZL_cterm2
Plasmid#222919PurposeCas9/sgRNA plasmid for targeting DAZLDepositorInsertCas9, DAZL sgRNA 2 (DAZL Synthetic, Human)
UseCRISPRAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_DAZL_cterm3
Plasmid#222920PurposeCas9/sgRNA plasmid for targeting DAZLDepositorInsertCas9, DAZL sgRNA 3 (DAZL Synthetic, Human)
UseCRISPRAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
1114H
Plasmid#200640PurposeAn. gambiae transgenesis plasmid. Expresses gRNAs targeting B2-tubulin, ZPG, and DSXF. Crossing to Cas9 generates sterile malesDepositorInsertgRNA targeting DSXF, ZPG, and B2-tubulin. Actin5c-CFP and Vasa2-EYFP reporters.
UseCRISPRExpressionInsectAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only
