We narrowed to 19,038 results for: REV;
-
Plasmid#118479PurposeNegative-control mutant for RAB-AKARev biosensor.DepositorInsertRAB-AKARev(T/A)
Tags6xHIS, T7 tag (gene 10 leader), and Xpress (TM) t…ExpressionMammalianMutationContains Thr-to-Ala mutation in substrate sequenc…PromoterCMVAvailable SinceDec. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-CDreV
Plasmid#140133Purposecan be used to generate AAV virus that will express fusion protein of split Dre (C-terminal) and fungal photoreceptor Vivid (VVD) monomerDepositorInsertCDreV
UseAAVPromoterEF1aAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pelB-MBP-RevA-ss
Plasmid#137064PurposeE. coli expression clone (T7lac promoter) for mature RevA (aa 25-160) from B. burgdorferi with N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavageDepositorInsertAAF07416.1 (revA Borrelia burgdorferi B31)
TagsPelB signal peptide + His10 + maltose binding pro…ExpressionBacterialMutationlacks the RevA signal peptide and 5 residues (CKA…PromoterT7lacAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEMB36(revcomp)/Dvl1_1_670
Plasmid#40557DepositorAvailable SinceOct. 1, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHU6_chr12_FAM19A2-up-gRNA-rev
Plasmid#81220PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the upstream region of FAM19A2 locusDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-IDS_DF_D1b_attB_rev
Plasmid#182152PurposeTo insert attB-rev attachment site at IDS in human cells via twinPEDepositorInsertIDS-D1b-attB-rev pegRNA
ExpressionMammalianPromoterhU6Available SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-IDS_DF_C2c_attB_rev
Plasmid#182151PurposeTo insert attB-rev attachment site at IDS in human cells via twinPEDepositorInsertIDS-C2c-attBrev pegRNA
ExpressionMammalianPromoterhU6Available SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHU6_Ch13_102010574-gRNA-rev
Plasmid#81219PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 5' region of pCALNL_Ch13 reporterDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_Ch12_62418577-gRNA-rev
Plasmid#81217PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 5' region of pCALNL_Ch12 reporterDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pN1_Rev-GR(m10)-EGFP
Plasmid#252751PurposeControl for studying nuclear export. Expression of a fusion protein containing full-length Rev, the hormone-responsive element of the rat Gr, and GFP. The m10 mutation abolishes nuclear export.DepositorInsertHIV-1 Rev and Glucocorticoid Receptor (GR)
TagsEGFPExpressionMammalianMutationm10 is mutation of nuclear export sequenceAvailable SinceMarch 19, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
Sc rev7-pRS405/GAL
Plasmid#241259PurposeOver-express Sc rev7 (Sc Pol zeta subunit) in yeast (integrated)DepositorInsertrev7 (REV7 Budding Yeast)
ExpressionYeastAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Rev7-Halo HRD
Plasmid#207079PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous REV7 locus.DepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human REV7 locus sequences
TagsHaloTagExpressionMammalianPromoterNoneAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Brevican scFv [N294A/6]
Plasmid#206772PurposeMammalian Expression of Brevican scFV. Derived from hybridoma N294A/6 scFv.DepositorAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLNHA-C1-HIV-Rev_O
Plasmid#147111PurposeMammalian Expression of HIV-RevDepositorInsertHIV-Rev
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-Brevican [N294A/6]
Plasmid#190309PurposeMammalian Expression Plasmid of anti-Brevican (Rat). Derived from hybridoma N294A/6.DepositorInsertanti-Brevican (Rattus norvegicus) recombinant Mouse monoclonal antibody (Bcan Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT5T_Rev7_1-211_SA112_KVK_Champ1_328-355
Plasmid#105638PurposeExpresses mouse monomeric Rev7 and fragment of Champ1 protein (amino acids 328-355) from bicistronic plasmidDepositorExpressionBacterialMutationMutations: F11S, G12A, V132K, C133V, A135KPromoterT7Available SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDOC-K-glmS-GFPrev
Plasmid#158060PurposeDonor plasmid for insertion of eGFP and the constitutive acpP promoter into the S. Typhimurium chromosome. GFP is in the reverse orientation relative to the kanamycin resistance selectable markerDepositorInsertGreen Fluorescent Protein optimised for excitation with UV light
UseSynthetic BiologyExpressionBacterialPromoteracpPAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRevA-TEV-His12
Plasmid#137034Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi RevA with C-terminal TEV-protease-cleavable His12DepositorInsertAAF07416.1 (revA Borrelia burgdorferi B31)
TagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHU6_Ch5_155183064-gRNA-rev
Plasmid#81215PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 5' region of pCALNL_Ch5 reporterDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only