We narrowed to 4,752 results for: IRES
-
Plasmid#112310PurposeCRISPR donor plasmid to tag human transcription factor CLOCK with GFPDepositorInsertCLOCK homology arms flanking EGFP-IRES-Neo cassette (CLOCK Human)
UseCRISPRMutationhg38:4:55435551:A>G, hg38:4:55435749:G>AAvailable sinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-Gluc-RMA-IRES-EGFP
Plasmid#189630PurposeExpresses Gluc-RMA and EGFP in the presence of Cre recombinase. Double-floxed Gluc-RMA and EGFP for monitoring Cre-expressing neuronal populations.DepositorInsertsGaussia luciferase fused to Fc
IRES-EGFP
UseAAV, Cre/Lox, and LuciferaseTagsGluc and IgG1 FcExpressionMammalianPromoterIRES and hSynAvailable sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMYs-MFN2-IRES-mitoRFP
Plasmid#121997PurposeExpression of MFN2 and mitoRFP in mammalial cellsDepositorInsertMFN2-IRES-mitoRFP (MFN2 Human)
UseRetroviralMutationsilent Q386Q Q387Q V388V Y389Y C390C E391E E392EAvailable sinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAGGS-GFP-WTUBA7-IRES-mcherry
Plasmid#246475PurposeMammalian expression of AcGFP-tagged WT human UBA7, co-expresses mCherry; for transfectionDepositorAvailable sinceApril 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
SOX2-P2A-NLS-mClover3-IRES-Puro
Plasmid#215544PurposeDonor plasmid for knock-in P2A-NLS-mClover3 into the human SOX2 locusDepositorInsertSOX2 homologous recombination arms with IRES-Puro selection cassette (SOX2 Human)
UseCRISPRAvailable sinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTL53_pyCAG-s36GFPmNG-IRES-mCherry3NLS-polyA
Plasmid#223545PurposeMinimal PUFFFIN cassette with s36GFP-mNeonGreen and mCherry-3NLS, separated by IRES, strong constitutive promoter CAG, no insulation or mammalian selection geneDepositorInserts36GFP-mNeonGreen, mCherry-3NLS
ExpressionMammalianPromoterCAGAvailable sinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
PMXS-EMC3-mScarlet-3xHA-IRES-bleomycin
Plasmid#255987PurposePMXS construct expressing EMC3-mScarlet-3xHA with an IRES-bleomycin cassette for ER-IPDepositorInsertEMC3-mScarlet-3xHA (EMC3 Human)
UseRetroviralTagsmScarlet-3xHAExpressionMammalianMutationN/AAvailable sinceJune 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHIV-ARF-mOrange2
Plasmid#110731PurposeMammalian Expression of p14ARF IRES H2B-mOrange2DepositorAvailable sinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Flag-PGC-1alpha1
Plasmid#45501DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPGC-1alpha Isoform1 (Ppargc1a Mouse)
Tags6xHis and FlagExpressionMammalianMutationQ339K relative to NM_008904Available sinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV-CAG-FLEX-BFP2-(mCherry)’
Plasmid#115234PurposeLentiviral transfer plasmid for expression of mTagBFP2 before Cre recombination and mCherry after itDepositorInsertmTagBFP2 and mCherry
ExpressionMammalianAvailable sinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTag-BFP-C-h-Rab7L1-c-Myc
Plasmid#79803PurposeExpress TagBFP labeled human Rab7L1.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRab7L1 (RAB29 Human)
TagsTagBFP and mycExpressionMammalianPromoterCMVAvailable sinceJuly 22, 2016AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV-EF1a-GFP-SFPQY527A-IRES-mCherry
Plasmid#166951PurposeLentiviral plasmid expressing GFP-tagged SFPQ Y527A protein with IRES-mCherry from the EF1a promoterDepositorInsertSFPQ-Y527A (SFPQ Human)
UseLentiviralTagsGFP and mCherryMutationSFPQ-Y527APromotereF1aAvailable sinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF1a-mRor2WT
Plasmid#22613DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRor2 WT (Ror2 Mouse)
TagsFlagExpressionMammalianAvailable sinceNov. 24, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
tet3G-cmv-FRB-SMG7C-IRES-FKBP-HaloTag_tdMCP-NLS-HA (tet3G-RIDR)
Plasmid#232461PurposeDox-inducible, high expression RIDRDepositorInserttet3G-cmv-FRB-SMG7C-IRES-FKBP-HaloTag-tdMCP-NLS-HA
TagsFKBP-HaloTag-tdMCP-NLS-HA and FRB-SMG7CExpressionMammalianPromotercmvAvailable sinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV floxed hMyoD-IRES-dsRed
Plasmid#66632Purposeco-expresses CRE excisable human MyoD and dsRedDepositorAvailable sinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBS rat IRS-1
Plasmid#11027DepositorInsertIRS-1 (Irs1 Rat)
ExpressionBacterialAvailable sinceMarch 1, 2006AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Lenti-DIO-P-EF1a-RPL22-3xHA-IRES-YFP
Plasmid#170327PurposeDouble-floxed inverse Orientation HA and IRES-YFP tagged RPL22DepositorAvailable sinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-APLP1ICD-IRES-hrGFP
Plasmid#107546PurposeAAV-mediated expression of last 50 amino acids of APLP1 protein (APLP1ICD) and IRES-mediated co-expression of hrGFP to recognize labelled cellsDepositorAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_SBP-EGFP-Ecadherin
Plasmid#65286Purposesynchronize trafficking of Ecadherin from the ER (RUSH system)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEcadherin
TagsEGFP and IL-2 Signal Sequence and Streptavidin Bi…ExpressionMammalianPromoterCMVAvailable sinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by