We narrowed to 81,735 results for: TRI
-
Plasmid#206201PurposeFor recombinant expression of the full heavy chain of the Mouse anti-MUC1 antibody 139H2 in mammalian cells. Includes a C-terminal -His8 tag for purification.DepositorInsertanti-MUC1 antibody 139H2 heavy chain (Ighg1 Mouse)
Tags-AAAHHHHHHHHExpressionMammalianPromoterCMVAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmirGLO-3'UTR-TNF
Plasmid#153069PurposeHuman TNF 3'UTR region cloned downstream of luciferase reporter geneDepositorAvailable SinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-mCherry-p53 deltaN
Plasmid#49243Purposeexpresses human p53 deltaN and mCherry in mammalian cellsDepositorInsertp53 deltaN (TP53 Human)
TagsIRES-mCherryExpressionMammalianMutationdeltaN ( lacks 39 residues at the N-terminus)PromoterCMVAvailable SinceDec. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLM-vexGFP-Oct4
Plasmid#22240Purpose2nd generation lentiviral vectorDepositorInsertvexGFP_2A_OCT4 (POU5F1 synthetic fluorescent protein, Human)
UseLentiviralAvailable SinceFeb. 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
pYX233-DHFR
Plasmid#163761PurposeGal-inducible yeast expression of cytosolic DHFRDepositorAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-mRuby3-WPRE
Plasmid#107744PurposeCan be used to express mRuby3. Can also be used to create adeno-associated virus for delivery of the mRuby3 sequence.DepositorInsertmRuby3
UseAAVExpressionMammalianPromoterCAGAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
R619-M87-303: CMV51p> SARS-CoV S-2P-T4f-3C-His8-Strep2x2
Plasmid#166012Purposemammalian expression of SARS-CoV soluble spike trimer proteinDepositorInsertSARS-CoV S (spike)
Tags3C-His8-Strep2x2ExpressionMammalianPromoterCMV51Available SinceMarch 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-TAPBPR
Plasmid#135500PurposeMammalian expression of FLAG-tagged TAPBPRDepositorInsertTAPBPR (TAPBPL Human)
TagsLuminal FLAG epitope tag and Signal peptide from …ExpressionMammalianPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-hOCT3/4-shp53-F + mCherry-2A-puro
Plasmid#74947PurposeDosage control and tracing of reprogramming episomesDepositorInsertOct3/4 (POU5F1 Human)
ExpressionMammalianAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only