We narrowed to 4,483 results for: Gaa
-
Plasmid#80196Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
NTRK2 gRNA (BRDN0001148065)
Plasmid#76468Purpose3rd generation lentiviral gRNA plasmid targeting human NTRK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TJP2 gRNA (BRDN0001147569)
Plasmid#77827Purpose3rd generation lentiviral gRNA plasmid targeting human TJP2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NEK4 gRNA (BRDN0001148553)
Plasmid#77711Purpose3rd generation lentiviral gRNA plasmid targeting human NEK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PPIP5K2 gRNA (BRDN0001148509)
Plasmid#76339Purpose3rd generation lentiviral gRNA plasmid targeting human PPIP5K2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP4K2B gRNA (BRDN0001147019)
Plasmid#77903Purpose3rd generation lentiviral gRNA plasmid targeting human PIP4K2BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pc2099-pEGFP-H3.1
Plasmid#241429PurposeExpresses human Histone H3.1 as fusion to GFP constructed by PCR using Primers: h3.1-cl-fw (AAGAATTCAATGGCTCGTACGAAGCAAAC) and h3.1-cl-rv (AAGCGGCCGCTGCCCTTTCCCCACGGATG) cloned into pEGFP-C1DepositorAvailable SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hITGB1-gRNA2
Plasmid#249223PurposeITGB1 CRISPR KODepositorAvailable SinceFeb. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCBS-4804
Plasmid#249320PurposeExpresses Non-targeting sgRNA and contains the Repair Template to replace the KanR* on the genome of E. coli MG1655DepositorInsertnontargeting sgRNA
ExpressionBacterialMutationN/AAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mGFAP(ABC1D)-2pabPAC
Plasmid#234547Purposeto express the optogenetic tool 2pabPAC, which increases cAMP levels when stimulated by blue light, in astrocytesDepositorInsert2pabPAC
UseAAVMutationNonePromotermGFAP(ABC1D)Available SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-11mer-35kb-DSF-1-11
Plasmid#227489Purpose11-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-LAP3
Plasmid#217661PurposeFor protein purification from EcoliDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crCoV-Mutiplex_EF1a-BFP
Plasmid#224788PurposeSARS-COV-2 targeting crRNA array for RfxCas13d expressed from single hU6 promoter and reporter BFP protein expressed from EF1a promoterDepositorInsertcrCoV20, crCoV21, crCoV24
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6 and hU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-CAPRIN1-ts1
Plasmid#174229PurposeCAPRIN1 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_FIGLA_cterm2
Plasmid#222907PurposeCas9/sgRNA plasmid for targeting FIGLADepositorInsertCas9, FIGLA sgRNA 2 (FIGLA Human, Synthetic)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_FIGLA_cterm1
Plasmid#222906PurposeCas9/sgRNA plasmid for targeting FIGLADepositorInsertCas9, FIGLA sgRNA 1 (FIGLA Human, Synthetic)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-puro_Panc480-MT7
Plasmid#200941PurposeMultiplexed CRISPR array expressing 7 sgRNA in a lentiviral backboneDepositorInsertmultiplexed sgRNA array
UseCRISPR and LentiviralExpressionMammalianPromoterhU6, EF-1aAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
LT3GEPIR-CCND1shRNA3
Plasmid#220579PurposeTo inducibly knockdown CCND1 expressionDepositorAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA435
Plasmid#215962PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; DR_v0 [EnAs]; sgCD274_v1; DR_v1 [EnAs]; sgADGRE5_v3; DR_v2; sgCD4_v1; DR_v3; sgDPP4_v1
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only