We narrowed to 1,478 results for: asl;
-
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pre-Ost1-alphaf(I)-Btl2
Plasmid#117667PurposeStudy secretion efficiency of Btl2DepositorInsertpre-Ost1-alphaf(I)-Btl2
UseTagsExpressionYeastMutationThis plasmid encodes the lipase Btl2 together wit…PromoterpAOX1Available sinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
-
123_pAAV-ProC1-CatCh-GFP-WPRE
Plasmid#125937PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProC1Available sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-ProC3-Cre/mCherry
Plasmid#126006PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCre-2A-mCherry
UseAAVTagsExpressionMutationPromoterProC3Available sinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
132_pAAV-ProB2-CatCh-GFP-WPRE
Plasmid#125922PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProB2Available sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
161_pAAV-ProD5-CatCh-GFP-WPRE
Plasmid#125981PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProD5Available sinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
113_pAAV-ProC21-CatCh-GFP-WPRE
Plasmid#125956PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProC21Available sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ProA1-GCaMP6s
Plasmid#126002PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGCaMP6s
UseAAVTagsExpressionMutationPromoterProA1Available sinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
I_pAAV-ProA6-CatCh-GFP-WPRE
Plasmid#125890PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProA6Available sinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ProA18-GCaMP6s
Plasmid#126004PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGCaMP6s
UseAAVTagsExpressionMutationPromoterProA18Available sinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
198_pAAV-ProD1-CatCh-GFP-WPRE
Plasmid#125977PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProD1Available sinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ProD1-GCaMP6s
Plasmid#126005PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGCaMP6s
UseAAVTagsExpressionMutationPromoterProD1Available sinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
VI_pAAV-ProA7-GFP-WPRE
Plasmid#125891PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGFP
UseAAVTagsExpressionMutationPromoterProA7Available sinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
70_pAAV-ProA23-CatCh-GFP-WPRE
Plasmid#125906PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProA23Available sinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
136_pAAV-ProA1-CatCh-GFP-WPRE
Plasmid#125886PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProA1Available sinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
57_pAAV-ProA14-CatCh-GFP-WPRE
Plasmid#125897PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProA14Available sinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only