We narrowed to 6,812 results for: KIT;

#178714

AAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of GFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)

Jordane Dimidschstein

Pouchelon et al Cell Rep Methods. 2022 May 26;2(6):10022

May 26, 2022

Academic Institutions and Nonprofits only

#89369

MosSCI targeting vector expressing a fusion between a GFP nanobody and an ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression is controlled by Pmec-18 (touch neuron specific).

Karen Oegema

Wang et al Development. 2017 Jun 15. pii: dev.15009

June 27, 2017

Academic Institutions and Nonprofits only

#178715

AAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of dTom in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)

Jordane Dimidschstein

Pouchelon et al Cell Rep Methods. 2022 May 26;2(6):10022

May 26, 2022

Academic Institutions and Nonprofits only

#111752

Intermediate vector containing HTT gene, except for polyQ region. Used to clone various polyQ lengths into HTT sequence with C-term FLAG tag. Baculovirus transfer vector for insect and mammalian cells

Cheryl Arrowsmith

Harding et al J Biol Chem. 2019 Apr 26;294(17):6986-70

Nov. 27, 2018

Academic Institutions and Nonprofits only

#165493

Neuronal expression of PACmn with dark Venus, a photoactivatable adenylyl cyclase derived from bPAC, membrane-anchored, no/reduced dark activity

Thomas Oertner

Yang et al BMC Biol. 2021 Oct 18;19(1):227. doi: 10

Oct. 21, 2021

Academic Institutions and Nonprofits only

#87384

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87397

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#162482

SEC plasmid containing LG1 homology arms and vha-8p::TIR1::F2A::BFP::AID*::NLS::tbb-2 3'UTR, for expression of TIR1 and nuclear BFP reporter in C. elegans.

Bob Goldstein

Ashley et al Genetics. 2021 Mar 31;217(3). pii: 61045

Jan. 11, 2021

Academic Institutions and Nonprofits only

#170850

AAV backbone for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of any transgene in cortical interneurons under the control of the Dlx enhancer.

Jordane Dimidschstein

Pouchelon et al Cell Rep Methods. 2022 May 26;2(6):10022

May 26, 2022

Academic Institutions and Nonprofits only

#170851

AAV backbone for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of any transgene in cortical interneurons under the control of the Dlx enhancer.

Jordane Dimidschstein

Pouchelon et al Cell Rep Methods. 2022 May 26;2(6):10022

May 26, 2022

Academic Institutions and Nonprofits only