We narrowed to 19,131 results for: Tat
-
Plasmid#120406Purposeenables eukaryotic expression of human plasma fibronectin in which the third O-glycosylation site was mutated from threonine to serineDepositorInsertFibronectin (FN1 Human)
ExpressionMammalianMutationContains complete variable region with a mutation…PromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRL2 PHO5(TATA-C2)pr ECFP (EB#1562)
Plasmid#14844DepositorInsertPHO5 promoter TATA-C2 (PHO5 Budding Yeast)
TagsECFPExpressionYeastMutationTATA-C2. TATA box mutated from TATATAAG to TCTA…Available SinceMay 25, 2007AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N-terminus T,S mutations (NT51)
Plasmid#49061PurposeExpresses human NKCC1 mutated Ser and Thr residues in the N-terminus and an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationS150N, S155Q, S170Q, T177A, S183R, S193E, T203A, …PromoterCMVAvailable SinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTwist-SARS-CoV-2 Spike-deltaC18 D614G (GGT) Q677H (CAT) D936Y (TAT)
Plasmid#212379PurposeEncodes SARS-CoV-2 spike D614G, Q677H, D936Y for pseudovirus productionDepositorInsertSARS-CoV-2 Spike D614G, Q677H, D936Y (S Severe acute respiratory syndrome coronavirus 2)
ExpressionMammalianMutationD614G, Q677H, D936YPromoterCAGAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-miRFP703-optoTAT(D157N)
Plasmid#255928Purposefor use with optoTAT systemDepositorInsertPacI-NheI(kozak)-NLS(c-Myc)X2-miRFP703-LEXY-GS-BamHI-GS-ATAT1(M1-S236, D157N)-Stop-NotI
UseLentiviralExpressionMammalianMutationD157N in alphaTAT1Promotermouse CMVAvailable SinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD214 HBS YB_TATA EYFP
Plasmid#253875PurposeEYFP reporter for the HBS(YB_TATA) promoterDepositorInsertHBS(YB_TATA) EYFP
UseSynthetic BiologyExpressionMammalianPromoterHBS(YB_TATA)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1350 HBS(YBTATA) LumiScarlet
Plasmid#253908PurposeComponents for Integration Vectors: mMoClo TUPV, with HBS(YB_TATA) promoter and LumiScarlet in the MCSDepositorInsertHBS(YB_TATA) LumiScarlet
UseSynthetic BiologyTags3xFLAGExpressionMammalianPromoterHBS(YB_TATA)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
(79-bp-DIAL-YB_TATA)-mGL-BGH_pKG1523
Plasmid#246329Purpose79-bp DIAL Reporter Plasmid with YB_TATA expressing mGreenLantern in the presence of ZFa and editable by Cre recombinaseDepositorInsertmGreenLantern
UseSynthetic BiologyExpressionMammalianMutationnoneAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
(27-bp-DIAL-YB_TATA)-mGL-BGH_pKG1524
Plasmid#246328Purpose27-bp DIAL Reporter Plasmid with YB_TATA expressing mGreenLantern in the presence of ZFa and editable by Cre recombinaseDepositorInsertmGreenLantern
UseSynthetic BiologyExpressionMammalianMutationnoneAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
SFFV-STAT6-Brd 352
Plasmid#219278PurposeTranscription factor STAT6 with a specific barcode assigned.DepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL69-TTAT
Plasmid#215850PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL69 with TTAT stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL69-TATT
Plasmid#215849PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL69 with TATT stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLeo-A-GEMS(JAK-STAT)
Plasmid#209109PurposeTransient mammalian expression of the CC functionalized GEMS receptor A-GEMS (JAK-STAT)DepositorInsertA-GEMS(JAK-STAT)
ExpressionMammalianAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLeo-B-a2-GEMS(JAK-STAT)
Plasmid#209112PurposeTransient mammalian expression of the CC functionalized GEMS receptor B-a2-GEMS (JAK-STAT)DepositorInsertB-a2-GEMS(JAK-STAT)
ExpressionMammalianAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLeo-G-a2-GEMS(JAK-STAT)
Plasmid#209113PurposeTransient mammalian expression of the CC functionalized GEMS receptor G-a2-GEMS (JAK-STAT)DepositorInsertG-a2-GEMS(JAK-STAT)
ExpressionMammalianAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
L0-I2 pPP2AA3-mutated GG0-GG1
Plasmid#195891PurposeLevel 0 pPP2AA3 promoter with GG0 and GG1 golden gate linkersDepositorInsertpPP2AA3
UseSynthetic BiologyAvailable SinceSept. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
px459-Mcm2-2A mutation sgRNA
Plasmid#186936PurposesgRNA used for genetic mutation at Y81 and Y90 of Mcm2DepositorInsertMcm2-2A mutation sgRNA (Mcm2 Mouse)
UseCRISPR and Mouse TargetingExpressionMammalianPromoterU6Available SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cherry-Plekhh1 5 silent mutations
Plasmid#187373PurposeExpresses human Plekhh1 with 5 silent mutations labelled with CherryDepositorInsertPlekhh1 with 5 silent mutations
TagsmCherryExpressionMammalianMutationFive silent mutations at the Plekhh1 siRNA site (…PromoterCMVAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMOD4-mT2A-mutated_rpsL-BSD-F
Plasmid#182338PurposeTemplate plasmid for PCR amplification of initial recombineering cassetteDepositorInsertBSD
UseMouse Targeting; Flp / frtExpressionBacterialAvailable SinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only