We narrowed to 5,431 results for: U6
-
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKAR1/Pur
Plasmid#23105PurposeAllows expression of shRNA from U6 promoter and a rescue cDNA from a doxycycline (Tet) inducible promoter in the same plasmid. Contains puromycin resistance geneDepositorTypeEmpty backboneUseRNAiTagsFlagExpressionMammalianPromoterTRE for cDNA; U6 for shRNAAvailable SinceMay 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide Cherry
Plasmid#170510PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and mCherry marker from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
mCherry
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC4 (pP18(T)_C11-AVA4065)
Plasmid#239302PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC4DepositorInsertU6-driven sgRNA targeting EXOSC4 (EXOSC4 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
gRNA[Tra].1026G
Plasmid#112689Purposeexpress gRNA targeting Tra under dU6-3 promoterDepositorInsertU6.3-gRNA[Tra] (tra Fly)
UseCRISPRAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDCC5
Plasmid#59984PurposeBi-cistronic Drosophila CRISPR/Cas9 vector, contains hsp70>Cas9-D10A nickase and U6>sgRNA cassetteDepositorInsertCas9-D10A
UseCRISPRTagsHAExpressionInsectMutationD10APromoterhsp70BbAvailable SinceOct. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-B
Plasmid#200825PurposeAAV transfer plasmid encoding a circularized RNA barcode B under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianPromoterhSynAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-C
Plasmid#200826PurposeAAV transfer plasmid encoding a circularized RNA barcode C under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianPromoterhSynAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-D
Plasmid#200827PurposeAAV transfer plasmid encoding a circularized RNA barcode D under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianPromoterhSynAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
U6.3>Control.gRNA.f+e
Plasmid#99140PurposeControl gRNA under the regulation of an optimized chicken specific U6 promoterDepositorInsertControl gRNA
UseCRISPRPromoterChicken U6.3Available SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only