We narrowed to 12,235 results for: HAL;
-
Plasmid#129272Purpose"ZF only" yTRAP control to control for yTRAP reporter fluorescence changes not dependent on sensed proteinDepositorInsertNLS-VP16-ZF 43-8-NES
Tags6xHAExpressionYeastPromoterSUP35Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVPromoterTREAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSK234
Plasmid#131149Purposedual yTRAP, Gateway destination vector of aTF2 fusion reporting on mKate2DepositorTypeEmpty backboneUseGateway destination vectorExpressionYeastAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSK260
Plasmid#129252Purposedual yTRAP, NM fusion to aTF1 reporting on [PSI+] state with mKate2 reporterDepositorInsertSup35 NM yTRAP sensor reporting on mKate2
ExpressionYeastAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSK247
Plasmid#131148Purposedual yTRAP, Gateway destination vector of aTF2 fusion reporting on mNeonGreenDepositorTypeEmpty backboneExpressionYeastPromoterpSUP35, min pCYC1Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSK226
Plasmid#129268Purposedual yTRAP, RNQ1 fusion to aTF2 reporting on [RNQ+] state with mNeonGreen reporterDepositorInsertRnq1
ExpressionYeastAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
TRE-mClover3
Plasmid#214922Purposeexpression vector control - contitutive expression of mClover3 aloneDepositorInsertmClover3
UseLentiviralAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-eYFP
Plasmid#117382PurposeAn AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertEYFP
UseAAVExpressionMammalianPromoterhSyn1Available SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MuHKII-pGFPN3
Plasmid#21922DepositorInsertMutant huamn HKII (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3 (HK2 Human)
TagsGFPExpressionMammalianMutationThis is the full length human HKII cDNA sequence …Available SinceOct. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEG302_dCAS9-MQ1(Q147L)_g4+g10+g18
Plasmid#172316PurposeCRISPR dCas9 directly fused to a variant of bacterial DNA methyltransferase MQ1 to target CG specific methylation to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_UBQ10_Ω_dCas9_MQ1(Q147L)_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNH11 (pmyo-2::Arch(D95N)::2xMycTag)
Plasmid#130275PurposeExpresses the voltage sensor Arch(D95N) in the pharynx of C. elegans.DepositorInsertArch(D95N)
Tags2x Myc-tagExpressionWormAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGAN201
Plasmid#129204PurposeyTRAP sensor of [RNQ+], detects aggregation of Rnq1DepositorAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNH13 (pmyo-2::QuasAr::mOrange)
Plasmid#130273PurposeExpresses the eFRET-based voltage sensor QuasAr::mOrange in the pharynx of C. elegans.DepositorInsertQuasAr::mOrange
TagsmOrangeExpressionWormAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGAN200
Plasmid#129203PurposeyTRAP sensor of [PSI+], detects aggregation of Sup35DepositorInsertSup35NM (SUP35 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationN terminal and middle domainsPromoterSUP35Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRE-mRuby3
Plasmid#214923Purposeexpression vector control - contitutive expression of mRuby33 aloneDepositorInsertmRuby3
UseLentiviralAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only