We narrowed to 3,361 results for: actin
-
Plasmid#115088PurposeBait vector BIR1 C9_pECIA2 should be used with prey vector BIR1 C9_pECIA14.DepositorInsertAT5G48380 (BIR1 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT3G28450 X043_pECIA2
Plasmid#115085PurposeBait vector AT3G28450 X043_pECIA2 should be used with prey vector AT3G28450 X043_pECIA14.DepositorInsertAT3G28450 (AT3G28450 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT3G14840 X033_pECIA2
Plasmid#115063PurposeBait vector AT3G14840 X033_pECIA2 should be used with prey vector AT3G14840 X033_pECIA14.DepositorInsertAT3G14840 (AT3G14840 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
NIK1 A11_pECIA2
Plasmid#114977PurposeBait vector NIK1 A11_pECIA2 should be used with prey vector NIK1 A11_pECIA14.DepositorInsertAT5G16000 (NIK1 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
NIK3 nA5_pECIA2
Plasmid#114969PurposeBait vector NIK3 nA5_pECIA2 should be used with prey vector NIK3 nA5_pECIA14.DepositorInsertAT1G60800 (NIK3 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT3G28450 X043_pECIA14
Plasmid#114885PurposePrey vector AT3G28450 X043_pECIA14 should be used with bait vector AT3G28450 X043_pECIA2.DepositorInsertAT3G28450 (AT3G28450 Mustard Weed)
ExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
BIR1 C9_pECIA14
Plasmid#114888PurposePrey vector BIR1 C9_pECIA14 should be used with bait vector BIR1 C9_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT3G14840 X033_pECIA14
Plasmid#114863PurposePrey vector AT3G14840 X033_pECIA14 should be used with bait vector AT3G14840 X033_pECIA2.DepositorInsertAT3G14840 (AT3G14840 Mustard Weed)
ExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
NIK1 A11_pECIA14
Plasmid#114777PurposePrey vector NIK1 A11_pECIA14 should be used with bait vector NIK1 A11_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
NIK3 nA5_pECIA14
Plasmid#114769PurposePrey vector NIK3 nA5_pECIA14 should be used with bait vector NIK3 nA5_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
Myc-Nix-S35A
Plasmid#197562PurposeMammalian expression of myc-tagged human Nix with an alanine substitution of serine-35. Based on Myc-Nix (#100795)DepositorInsertBCL2 interacting protein 3 like (BNIP3L Human)
TagsMycExpressionMammalianMutationSerine 35 changed to alaninePromoterCMVAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
Myc-Nix-S35D
Plasmid#197563PurposeMammalian expression of myc-tagged human Nix with an aspartic acid substitution of serine-35. Based on Myc-Nix (#100795)DepositorInsertBCL2 interacting protein 3 like (BNIP3L Human)
TagsMycExpressionMammalianMutationSerine 35 changed to aspartic acidPromoterCMVAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-tBid-2E-pEGFP-C1
Plasmid#166747PurposeExpress Venus fused to the N-terminus of the Bcl-2 family protein, tBid with mutation to 2 positions in the BH3 domainDepositorInserttBid-2E (Bid Mouse)
TagsVenusExpressionMammalianMutation2 hydrophobic residues in the BH3 region mutated …PromoterCMVAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-eGFP-FRT-T0-RNF168 delta MIU1/MIU2
Plasmid#133980Purposeinducible mammalian expression vector of eGFP tagged RNF168 where both motifs interacting with ubiquitin have been deletedDepositorInsertRNF168 (RNF168 Human)
TagseGFPExpressionMammalianMutationdeletion of MIU1 and MIU2PromoterCMVAvailable SinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
Venus-tBid-4E-pEGFP-C1
Plasmid#166743PurposeExpress Venus fused to the N-terminus of the Bcl-2 family protein, tBid with mutation in BH3 domain to disrupt binding anti-apoptotic proteinsDepositorInserttBid-4E (Bid Mouse)
TagsVenusExpressionMammalianMutation4 hydrophobic residues in the BH3 region mutated …PromoterCMVAvailable SinceMarch 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/GFP-GIGYF2
Plasmid#141189PurposeExpresses GFP-GIGYF2 in mammalian cells, can be used to make inducible cell lineDepositorAvailable SinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
cmamxA2-GFP
Plasmid#107197PurposeExpresses human annexin A2-GFP fusion protein for live cell imaging, all type II Ca2+ binding sites deletedDepositorInsertcmannexin A2 (ANXA2 Human)
TagsGreen Fluorescent ProteinExpressionMammalianMutationall type II Ca2+ binding sites deleted ( D161A, E…PromoterCMVAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-RIPK2
Plasmid#23846DepositorInsertRIPK2 (RIPK2 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-RIPK1
Plasmid#23442DepositorInsertRIPK1 (RIPK1 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag MKNK1
Plasmid#20536DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-hTRF1-tagRFP-T
Plasmid#103811PurposeBLInCR 'Localizer' construct that marks telomeres and is targeted by a PHR-tagged effector upon illumination with blue light; can be visualized without triggering PHR recruitmentDepositorAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-MKNK1
Plasmid#23531DepositorInsertMKNK1 (MKNK1 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-TNNI3K
Plasmid#23469DepositorInsertTNNI3K (TNNI3K Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-MKNK2
Plasmid#23735DepositorInsertMKNK2 (MKNK2 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7WT-VA
Plasmid#115182PurposeLentiviral transduction and expression of PARK7WT into any mammalian cellDepositorInsertPARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag PDIK1L
Plasmid#20644DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ACE2 receptor 19-615
Plasmid#167012PurposeGateway-compatible Entry vector encoding ACE2 receptor (aa19-615) interacting with spike (S1) RBD domain from SARS-CoV-2DepositorAvailable SinceMarch 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGG369
Plasmid#165606PurposeVector for expression of ω-dCas9 and sgRNA in E. coli: lacUV2-ω-1xFLAG-dCas9(Wt PID)-1xNLS-3xHA-1xNLS and UV5-BsaI-sgRNA (BsaI sites in place of the spacer)DepositorInsertω-1xFLAG-dCas9(PAM-interacting domain and overall coding scheme from Wt SpCas9)-1xNLS-3xHA-1xNLS and BsaI-sgRNA
UseCRISPR and Synthetic BiologyTags1x FLAG, 3x HA, Omega (ω) subunit of RNA polymera…ExpressionBacterialMutationRecoding of BsaI site in the AmpR cassette, two B…PromoterlacUV2 driving ω-dCas9 and UV5 driving sgRNAAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PDIK1L
Plasmid#23738DepositorInsertPDIK1L (PDIK1L Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLPC-NMYC-hTRF1deltaBLM
Plasmid#64165PurposeRetroviral vector expressing human TRF1 delta aa317-374 with N-terminal MYC tagDepositorInserthTRF1 (TERF1 Human)
UseRetroviralTagsMycExpressionMammalianMutationdeleted amino acids aa317-374 of human TRF1PromoterCMVAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-ER WPRE
Plasmid#236230PurposeAAV expression of a fluorescent marker, mEmerald fused to Prolactin signal peptide and KDEL sequence; for expression and retention in the lumen of the endoplasmic reticulumDepositorInsertmEmerald-PRL signal peptide-KDEL sequence (PRL Bovine)
UseAAVTagsmEmeraldPromoterhuman Synapsin 1Available SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Myc-Nix-S212D
Plasmid#197515PurposeMammalian expression of myc-tagged human Nix with an aspartic acid substitution of serine-212. Based on Myc-Nix (#100795)DepositorInsertBCL2 interacting protein 3 like (BNIP3L Human)
TagsMycExpressionMammalianMutationSerine 212 changed to aspartic acidPromoterCMVAvailable SinceMarch 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
Myc-Bnip3-T181A
Plasmid#197556PurposeMammalian expression of myc-tagged mouse Bnip3 with an alanine substitution of threonine-181. Based on Myc-Bnip3FL (#100796)DepositorInsertBCL2 Interacting Protein 3 (Bnip3 Mouse)
TagsMycExpressionMammalianMutationThreonine 181 changed to alaninePromoterCMVAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Myc-Nix-S212A
Plasmid#197514PurposeMammalian expression of myc-tagged human Nix with an alanine substitution of serine-212. Based on Myc-Nix (#100795)DepositorInsertBCL2 interacting protein 3 like (BNIP3L Human)
TagsMycExpressionMammalianMutationSerine 212 changed to alaninePromoterCMVAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3-hAP1 1-419
Plasmid#183644PurposeTo (ectopically) express a mutant of ATP6AP1 lacking the interacting domain with PEN2; mammalian expressionDepositorInsertATP6AP1 (ATP6AP1 Human)
TagsmycExpressionMammalianMutationtruncated ATP6AP1 mutant; contains only amino aci…PromoterCMVAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBoBi-hAP1 Δ420-440
Plasmid#183642PurposeTo (stably) express a mutant of ATP6AP1 lacking the interacting domain with PEN2; lentiviral expressionDepositorInsertATP6AP1 (ATP6AP1 Human)
UseLentiviralTagsHAMutationtruncated ATP6AP1 mutant lacking the transmembran…PromoterCMVAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7V51G-VA
Plasmid#115183PurposeLentiviral transduction and expression of PARK7V51G into any mammalian cellDepositorInsertPARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.V51GPromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7C53A-VA
Plasmid#115184PurposeLentiviral transduction and expression of PARK7C53A into any mammalian cellDepositorInsertPARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.C53APromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7H126A-VA
Plasmid#115185PurposeLentiviral transduction and expression of PARK7H126A into any mammalian cellDepositorInsertPARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.H126APromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7E163K-VA
Plasmid#115186PurposeLentiviral transduction and expression of PARK7E163K into any mammalian cellDepositorInsertPARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.E163KPromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-HIPK2
Plasmid#23481DepositorInsertHIPK2 (HIPK2 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-HIPK3
Plasmid#23467DepositorInsertHIPK3 (HIPK3 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-RIPK5
Plasmid#23662DepositorInsertRIPK5 (DSTYK Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ASCIZ
Plasmid#23571DepositorInsertASCIZ (ATMIN Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-HIPK4
Plasmid#23760DepositorInsertHIPK4 (HIPK4 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-LOC389599
Plasmid#23361DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-MAP2K1IP1
Plasmid#23694DepositorInsertMAP2K1IP1 (LAMTOR3 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3-hAP1 420-440
Plasmid#183643PurposeTo (ectopically) express a mutant of ATP6AP1 lacking the interacting domain with PEN2; mammalian expressionDepositorInsertATP6AP1 (ATP6AP1 Human)
TagsmycExpressionMammalianMutationtruncated ATP6AP1 mutant; contains only the trans…PromoterCMVAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only