We narrowed to 13,363 results for: BASE
-
Plasmid#172835PurposeMammalian expression of a sgRNA targeting the intron 1 of Tuba1b (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Tuba1b under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJY-RpABE-FT_INF
Plasmid#112874Purposebinary vector for INF (Induced Neo-Functionalization) of FT in ArabidopsisDepositorInsertsRPS5A promoter
ABE7.10
U6-sgRNA targeting FT
UseCRISPRExpressionPlantAvailable SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
MyoUTipGAPi
Plasmid#127549PurposePositive RNAi control for pGAPi-based RNAi silencing in tandem with APT transcript segmentDepositorInsertMyosin XIa+b 5'UTR and Adenine Phosphorybosyltransferase transcript segment
UseRNAi; Positive controlPromoterUbiquitinAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eBE-S1
Plasmid#101092PurposeExpresses eBE-S1 in mammalian cellsDepositorInserteBE-S1
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEN_TmiR_G13-L
Plasmid#25762PurposeEntry vector with TRE promoter driving mouse G alpha 13 miR30-based shRNA.DepositorInsertG alpha 13 miR-shRNA
UseGateway CloningAvailable SinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP60
Plasmid#247216PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP34
Plasmid#247209PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP34∆RBS
Plasmid#247213PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP35∆RBS
Plasmid#247214PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCas9_antiBFP
Plasmid#220922PurposeExpresses Cas9 with a BFP targeting crRNA for use in targeting the BFP plasmid in a cell based assayDepositorInsertpCas9
ExpressionBacterialAvailable SinceMarch 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCas9_antiGFP
Plasmid#220923PurposeExpresses Cas9 with a GFP targeting crRNA for use in targeting the GFP plasmid in a cell based assayDepositorInsertpCas9
ExpressionBacterialAvailable SinceMarch 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCas9_antiOFP
Plasmid#220924PurposeExpresses Cas9 with a OFP targeting crRNA for use in targeting the OFP plasmid in a cell based assayDepositorInsertpCas9
ExpressionBacterialAvailable SinceMarch 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPB-[EF1a-mRuby2-bGH]-UbC-PuroR-T2A-mGL-SV40pA
Plasmid#235325PurposePiggyBac integration vector for ComMAND base gene regulating mRuby2DepositorInsertmRuby2
UseSynthetic Biology; PiggybacExpressionMammalianPromoterEF1a (human EF1a)Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT16
Plasmid#223388PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NGG PAM; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpCas9-D10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-mRuby2-bGH]-EFS-rtTA-T2A-mGL-P2A-PuroR-WPRE
Plasmid#235268PurposeLentiviral expression of ComMAND base gene regulating mRuby2DepositorInsertmRuby2
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT41
Plasmid#223413PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for monocot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants select.DepositorInsertZmUbi-ecTadA8e-SpRY-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT26
Plasmid#223398PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for dicot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 was driven by ZmUbi1 and the sgRNA was driven by AtU3; BASTA for plants select.DepositorInsertZmUbi-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-AtU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT29
Plasmid#223401PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for monocot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 was driven by ZmUbi1 and the sgRNA was driven by OsU3; BASTA for plant select.DepositorInsertZmUbi-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT30
Plasmid#223402PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for monocot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 and the sgRNA was driven by separate ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-ZmUbi-gRNA scaffold 2.0-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only