We narrowed to 24,551 results for: p
-
Plasmid#202218PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Tetracyline selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertpBCC25, pBCC30, pBCC55, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBCC092
Plasmid#202219PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Tetracyline selectable marker and AmCyan1 fluorescent markerDepositorInsertpBCC25, pBCC30, pBCC56, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBCC093
Plasmid#202220PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Tetracyline selectable marker and tagRFP fluorescent markerDepositorInsertpBCC25, pBCC30, pBCC58, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBCC095
Plasmid#202221PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Kanamycin selectable marker and GFP fluorescent markerDepositorInsertpBCC25, pBCC32, pBCC57, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBCC096
Plasmid#202222PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Tetracyline selectable marker and GFP fluorescent markerDepositorInsertpBCC25, pBCC30, pBCC57, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBCC097
Plasmid#202223PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Tetracyline selectable marker and tagBFP fluorescent markerDepositorInsertpBCC25, pBCC30, pBCC59, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBCC098
Plasmid#202224PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Kanamycin selectable marker and AmCyan1 fluorescent markerDepositorInsertpBCC25, pBCC32, pBCC56, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBCC099
Plasmid#202225PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Kanamycin selectable marker and tagRFP fluorescent markerDepositorInsertpBCC25, pBCC32, pBCC58, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBCC100
Plasmid#202226PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Kanamycin selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertpBCC25, pBCC32, pBCC55, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pegRNA_HEK4_1bp-insertion
Plasmid#201977PurposeExpress a pegRNA used for 1bp insertion at HEK4 siteDepositorInsertpegRNA_HEK4_1bp-insertion
ExpressionMammalianAvailable SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/sh-FYN1-GFP_Seq_C
Plasmid#201399PurposeKnockdown of FYN tyrosine kinase. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertFYN
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGA-red-mini
Plasmid#196338PurposeEasy-MISE toolkit Level 1 destination plasmid for cassette cloning with BsaI-based Golden Gate Assembly; allowing fast postitive clones test with mRFP1 fluorescent protein-based red/white screeningDepositorTypeEmpty backboneUseSynthetic Biology; Golden gate assembly backboneAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGA-red-maxi
Plasmid#196337PurposeEasy-MISE toolkit Level 1 destination plasmid for cassette cloning with BsaI-based Golden Gate Assembly; allowing fast postitive clones test with mRFP1 fluorescent protein-based red/white screeningDepositorTypeEmpty backboneUseSynthetic Biology; Golden gate assembly backboneAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRPromotermouse U6Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA29-pCS2-CMV-Zebrafish NarTag (eGFP)
Plasmid#199460PurposeExpression of Zebrafish NarTag (eGFP harbors 9XMS2 in its intron) in zebrafish embryosDepositorInsertZebrafish NarTag
ExpressionMammalianPromoterCMVAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
puc19_N_tag
Plasmid#186650PurposeEmpty donor plasmid.DepositorInsertN-terminal 3xFlag-3xHA Tag
Tags3xFlag-3xHAExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-Flag-BirA-Linker-Myc-mRap1-I312R
Plasmid#184645PurposeRetroviral expression of BirA Rap1 I312RDepositorInsertBirA-rap1-I312R
UseRetroviralTagsBirA FLAGExpressionMammalianPromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-zfKitlga
Plasmid#168199PurposeExpress zebrafish Kitlga, mRNA synthesisDepositorInsertKitlga (kitlga Zebrafish)
UseVertebrate expression (zebrafish, chicken, xenopu…ExpressionMammalianMutationF198L - please see depositor commentsAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
GSX2-P2A-tGFP-DTA
Plasmid#161750PurposetGFP plasmid for the c-terminal targeting of human GSX2 locusDepositorInsertturboGFP
UseCRISPRTagsP2A-tGFPExpressionMammalianPromoterendogenous GSX2 promoterAvailable SinceDec. 14, 2020AvailabilityAcademic Institutions and Nonprofits only