We narrowed to 5,470 results for: crispr cas9 grna plasmid
-
Plasmid#176259PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and spacer sequence on sgRNA is replaced by the type IIS restriction site for endonuclease BaeI andDepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
peSpCas9(1.1)-2×sgRNA (empty, donor)
Plasmid#80768PurposeAll-in-one vector for CRISPR/Cas9-mediated homology-independent knock-in system. The plasmid contains eSpCas9(1.1) and two sgRNA expression cassettes. The first gRNA cloning site is empty.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMST665_BB3_L 23_gRNAempty_cas9_BbsI
Plasmid#90278PurposeBB3_L 23_gRNAempty_cas9_BbsI; CRISPR plasmid with empty gRNA spacer to incorporate gRNA, Cas9DepositorInsertCas9
UseA. nigerExpressionBacterialAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-Cas9-gRNA-TagBFP2
Plasmid#124774Purpose3rd generation lentiviral plasmid encoding Cas9, TagBFP2, and a gRNA backboneDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_LP1B_St1Cas9_LMD-9_SpA_U6_sgRNA
Plasmid#110624PurposeA single vector AAV-Cas9 system containing a liver-specific promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNADepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
UseAAV, CRISPR, and Mouse TargetingTagsSV40 NLSExpressionMammalianPromoterLP1B and hU6Available SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td2
Plasmid#176258PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td1
Plasmid#176257PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 1DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Cas9-2A-GFP-sgRNA
Plasmid#124889PurposeContains spCas9-2A-GFP and guide RNA scaffold in single retroviral vectorDepositorInsertCas9
UseRetroviralTags2A-GFPPromoterMSCVAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only