We narrowed to 7,219 results for: cas9 plasmid
-
Plasmid#159903PurposeMutagenesis of Oprk1DepositorInsertOprk1 (Oprk1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgNts
Plasmid#159909PurposeMutagenesis of NtsDepositorInsertNts (Nts Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
BlatCas9
Plasmid#163792PurposeThe plasmid expresses human codon-optimized BlatCas9 and gRNA expression elements.DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
dCas9v2
Plasmid#103140PurposeTetR inducible dCas9-VPR plasmid with pRPR-NotI-tRPR1 Csy4-ready siteDepositorInsertdCas9-VPR
ExpressionYeastMutationRemoved scaffold gRNA from original plasmidAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgRosa26
Plasmid#159914PurposeMutagenesis of Rosa26 with SauCas9DepositorInsertRosa26 gRNA (Gt(ROSA)26Sor Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEXfrt-SaCas9-U6-sgRosa26
Plasmid#159915PurposeMutagenesis of Rosa26DepositorInsertRosa26 (Gt(ROSA)26Sor Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgTh
Plasmid#159901PurposeMutagenesis of ThDepositorInsertTh (Th Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-MYC-Guide-hSpCas9
Plasmid#228574PurposeExpression of human MYC gRNA; CRISPR mediated gene insertionDepositorAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MP-84-spCas9-U6-gRNA-tlock
Plasmid#206936PurposeExpression of spCas9 endonuclease and gRNA in an AAV vector allowing packaging of viral genome smaller than 5 kb.DepositorInsertspCas9
UseAAVTagsSV40 NLSExpressionMammalianPromoterMP-84Available SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnq3
Plasmid#159911PurposeMutagenesis of Kcnq3DepositorInsertKcnq3 (Kcnq3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgDcc
Plasmid#159906PurposeMutagenesis of DccDepositorInsertDcc (Dcc Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_iC
Plasmid#231418PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-C1. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ290.)DepositorInsertsdCas9
GFP
UseSynthetic BiologyAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_iA
Plasmid#231417PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-A1. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ285.)DepositorInsertsdCas9
GFP
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgSlc32a1
Plasmid#159905PurposeMutagenesis of Slc32a1DepositorInsertSlc32a1 (Slc32a1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgPenk
Plasmid#159916PurposeMutagenesis of PenkDepositorInsertPenk (Penk Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgDrd1
Plasmid#159917PurposeMutagenesis of Drd1DepositorInsertDrd1 (Drd1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgDrd2
Plasmid#159918PurposeMutagenesis of Drd2DepositorInsertDrd2 (Drd2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnn3
Plasmid#159904PurposeMutagenesis of Kcnn3DepositorInsertKcnn3 (Kcnn3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only