We narrowed to 4,498 results for: 187
-
Plasmid#58894PurposeExpresses GFP tagged TEM4 with N terminus deletedDepositorInsertTEM4 (ARHGEF17 Human)
TagsEGFPExpressionMammalianMutationDeleted N Terminus up to aa 1002PromoterCMVAvailable SinceSept. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.5-Fc-His
Plasmid#72102PurposeExpresses the extracellular region of the Neuropilin 2, isoform 5 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAH-MIBP16
Plasmid#51870PurposeExpresses C-terminal HA-tagged full length rat MIBP1 (cloned into pCAGGS)DepositorAvailable SinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.1-AP-His
Plasmid#71972PurposeExpresses the extracellular region of the Neuropilin 2, isoform 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.3-Fc-His
Plasmid#72100PurposeExpresses the extracellular region of the Neuropilin 2, isoform 3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.4-Fc-His
Plasmid#72101PurposeExpresses the extracellular region of the Neuropilin 2, isoform 4 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFUW-TetO-E2F2
Plasmid#207187Purposedoxycycline-inducible expression of Human E2F2 in mammalian cellsDepositorInsertpFUW-TetO-E2F2
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGFP-C-IFT46
Plasmid#218724PurposeExpresses N-terminally EGFP-tagged IFT46 in mammalian cellsDepositorAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-IFT25
Plasmid#218721PurposeExpresses N-terminally EGFP-tagged IFT25 in mammalian cellsDepositorAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF1601
Plasmid#144187PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1830
Plasmid#141876PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1820
Plasmid#141874PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1728
Plasmid#141870PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1747
Plasmid#141871PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1-LanCL2-H264A-C-Ter-His
Plasmid#154187PurposeTo express LanCL2-H264A in bacterial cellsDepositorInsertLanCL2
TagsHexahistidineExpressionBacterialMutationHis264->Ala264Available SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Dscam1_7.27.23 EC10-Fc-His
Plasmid#72187PurposeExpresses the 10 N-terminal extracellular domains of the Dscam, isoform 7.27.23 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertDscam1_7.27.23
TagsFc-HisExpressionMammalianPromoterCMVAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
MMW3645 - human expression plasmid for SpCas9 Cluster 3
Plasmid#101187PurposeHuman expression plasmid for SpCas9 Cluster 3 variant: CMV-T7-hSpCas9-Cluster3(T657A, G658A, W659A, R661A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-Cluster3(T657A/G658A/W659A/R661A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationT657A/G658A/W659A/R661APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001147649)
Plasmid#80187Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.6-Fc-His
Plasmid#72103PurposeExpresses the extracellular region of the Neuropilin 2, isoform 6 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only