-
Plasmid#232057PurposeExpresses construct for surface tethering: R. norvegicus NFH tail domainDepositorInsertNeurofilament-Heavy tail domain
UseTags6xHisExpressionBacterialMutationadded N-terminal tryptophan and tyrosine, and cys…PromoterAvailable sinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m1
Plasmid#204463PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR A127N mutation.DepositorInsertsUseSynthetic BiologyTagsExpressionMutationLasR A127N mutationPromoterIn an operon and PLasAvailable sinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m2
Plasmid#204464PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L128C mutation.DepositorInsertsUseSynthetic BiologyTagsExpressionMutationLasR L128C mutationPromoterIn an operon and PLasAvailable sinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m3
Plasmid#204465PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L125W-A127S mutation.DepositorInsertsUseSynthetic BiologyTagsExpressionMutationLasR L125W-A127S mutationPromoterIn an operon and PLasAvailable sinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m4
Plasmid#204466PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L125W-A127T mutation.DepositorInsertsUseSynthetic BiologyTagsExpressionMutationLasR L125W-A127T mutationPromoterIn an operon and PLasAvailable sinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m5
Plasmid#204467PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L125F-A127G-S129N mutation.DepositorInsertsUseSynthetic BiologyTagsExpressionMutationLasR L125F-A127G-S129N mutationPromoterIn an operon and PLasAvailable sinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m6
Plasmid#204468PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L125W-S129N-L130V mutation.DepositorInsertsUseSynthetic BiologyTagsExpressionMutationLasR L125W-S129N-L130V mutationPromoterIn an operon and PLasAvailable sinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m7
Plasmid#204469PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L125W-A127T-L128M mutation.DepositorInsertsUseSynthetic BiologyTagsExpressionMutationLasR L125W-A127T-L128M mutationPromoterIn an operon and PLasAvailable sinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-2xMS2
Plasmid#212627PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-2xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-12xMS2
Plasmid#212628PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-12xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-4xMS2
Plasmid#212626PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-4xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL475
Plasmid#219503PurposeExpress Ade2, Can1 and Faa1 retron msd donor-gRNAs from a single Gal7 promoter, separated by a Csy4 recognition sequence, with an msr expressed in transDepositorInsertAde2, Can1 and Faa1 retron msd donor-gRNAs separated by a Csy4 recognition sequence, with an msr expressed in trans
UseTagsExpressionYeastMutationPromoterGAL7Available sinceMay 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMAT_CD28ICD
Plasmid#197098PurposeThis plasmid contains the coding sequence for the intracellular domain of CD28. Digest this insert and add it to pHR_pSFFV_scFVCD19_CD8a_CD3zP2AEGFPDepositorInsertThis plasmid contains the coding sequence for the intracellular domain of CD28.
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGG-GTS-TurboID
Plasmid#209397PurposeTransiently expressing TurboID fused with a Golgi targeting sequence (GTS) in plantaDepositorInsertGTS-3XHA-TurboID
UseTagsExpressionPlantMutationTurboID gene sequence C249APromoterCauliflower mosaic virus (CaMV) 35S promoterAvailable sinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR2_IRdist_scram
Plasmid#162319PurposeP. aeruginosa PA14 CRISPR2 locus, with a scrambled distal Inverted Repeat of the upstream motifDepositorInsertPseudomonas aeruginosa PA14 CRISPR2 locus
UseTagsExpressionBacterialMutationThe distal Upstream Motif site is scrambledPromoterpBADAvailable sinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
Plasmid#193050PurposeEncodes guide RNA expression targeting PX740 landing padDepositorInsertGuide RNA
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pASPIre4
Plasmid#196656PurposeDerivative of pASPIre3. Contains SpeI restriction site within the CDS of bxb1 to enable diversification of the 5’-UTR and codons 2-16.DepositorInsertBxb1-sfGFP fusion controlled by rhamnose promoter; attB/attP-flanked discriminator; exchangable 5'-UTR and CDS (codons 1-16)
UseTagsExpressionBacterialMutationSpeI site in Bxb1 CDSPromoterrhamnose-inducible promoterAvailable sinceAug. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
TEG +Q111T
Plasmid#187435PurposeExpresses Na,K-ATPase (ATP1A1 and ATP1B1 in pFastBac Dual vector) in insect cellsDepositorInsertsATP1A1
ATP1B1
UseTagsExpressionInsectMutationchanged glutamine at 117 to threoninePromoterPH and p10Available sinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEM.F02R
Plasmid#198662PurposeEasy-MISE toolkit pEM-plasmid containing GFP coding sequence preceded by a linker sequence with HI protruding endsDepositorInsertlinker+GFP
UseSynthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEM.F02L
Plasmid#198661PurposeEasy-MISE toolkit pEM-plasmid containing GFP coding sequence preceded by a linker sequence with CD protruding endsDepositorInsertlinker+GFP
UseSynthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only