We narrowed to 1,759 results for: plasmid for e coli
-
Plasmid#68939PurposeE. coli/staphylococcal temperature-sensitive plasmid for allelic exchangeDepositorTypeEmpty backboneUseStaphylococcal allelic exchange vectorAvailable SinceSept. 29, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pSB1C3-J23110-B0034-mRFP1_Yellow
Plasmid#160443PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Yellow chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Yellow
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Violet
Plasmid#160447PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Violet chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Violet
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1E
Plasmid#160442PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1 chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL4.26-SS-352
Plasmid#68791PurposeZF9 Op x6 -- GFP-IRES-NTRDepositorInsertsZF9 Op 6x
EGFP
Nitroreductase
TagsIRESExpressionMammalianAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28a_LolT_C41S
Plasmid#211789PurposeExpression plasmid in E. coli BL21(DE3) , which can be used for expression and purification to get protein LolT_C41SDepositorInsertlolt mutant
TagsHis tagExpressionBacterialPromoterT7 promoterAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Magenta
Plasmid#160446PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Magenta chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Magenta
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQDKN0248
Plasmid#162313PurposeReporter plasmid for T7-driven E. coli cell-free protein synthesis with detection via HiBiTDepositorInsertT7prom-RBS-sfGFP-HiBiT
UseSynthetic BiologyAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Pink
Plasmid#160445PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Pink chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Pink
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0KN0245
Plasmid#162284PurposeAcceptor for golden gate assembly with BsaI overhangs GCTT-CCAT. Generates plasmids for T7-driven E. coli cell-free protein synthesisDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQDKN0729
Plasmid#162316PurposeTEV protease plasmid for T7-driven E. coli cell-free protein synthesisDepositorInsertT7prom-RBS-NET-TEVprotease
UseSynthetic BiologyAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Orange
Plasmid#160444PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Orange chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Orange
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPMY1CB0001
Plasmid#162317PurposeAcceptor for golden gate assembly with BsaI overhangs GCTT-CCAT. Generates plasmids for T7-driven expression in E. coli. Contains mRFP1 reporter.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0KN0025
Plasmid#162283PurposeAcceptor for golden gate assembly with BsaI overhangs GCTT-AATG. Generates plasmids for T7-driven E. coli cell-free protein synthesisDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pXD70DA9-Pct5-DadhABC(A2)
Plasmid#191632PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5-dopamine dehydroxylase from dopamine-metabolizing E. lenta A2 strainDepositorInsertDopamine dehydroxylase
ExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGB1alpha2_SulR
Plasmid#186425Purposetranscriptional unit for sulfadiazine resistance; plant expression driven by the Pnos promoterDepositorInsertSulR
UseSynthetic Biology; Binary vector for escherichia …ExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70Tet(DadH)-Pdadh-DadhABC(A2)
Plasmid#191644PurposeE. coli - Eggerthella lenta shuttle plasmid (TetR), native promoter-dopamine dehydroxylase from dopamine-metabolizing E. lenta A2 strainDepositorInsertDopamine dehydroxylase
ExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCasSA
Plasmid#98211PurposeCRISPR-based E. coli/Staphylococcus aureus temperature-sensitive plasmid for genome editing in Staphylococcus aureus using S. pyogenes Cas9DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only